Difference between revisions of "20.109(S18):Class data"

From Course Wiki
Jump to: navigation, search
(M1D5: PPIase Assay Results)
(T/R Battery Information)
 
(83 intermediate revisions by 22 users not shown)
Line 90: Line 90:
 
[[Media: Sp18_ChosenCompounds.pdf|List of Chosen Compounds]]<br>
 
[[Media: Sp18_ChosenCompounds.pdf|List of Chosen Compounds]]<br>
 
[[Media:Sp18 FKBP12 unique hits SMILES.xlsx|List of Compounds with SMILES]]<br>
 
[[Media:Sp18 FKBP12 unique hits SMILES.xlsx|List of Compounds with SMILES]]<br>
 +
[[Media:Sp18 FKBP12 unique hits SMILESwithTeams.xlsx|List of Compounds with SMILES and Teams]]<br>
  
 
===M1D4: Protein Gel Images===
 
===M1D4: Protein Gel Images===
Line 150: Line 151:
 
|-
 
|-
 
|}
 
|}
 +
  
  
Line 181: Line 183:
 
|-
 
|-
 
|Yellow
 
|Yellow
|[[Media:Sp18_TRyellowPPIase.xls|Sp18_TRyellow_PPIase]]
+
|[[Media:Sp18_TRyellow_PPIase.xlsx|Sp18_TRyellow_PPIase]]
 
|-
 
|-
 
|Green
 
|Green
Line 196: Line 198:
 
|-
 
|-
 
|White
 
|White
|[[Media:Sp18_TRwhitePPIase.xls|Sp18_TRwhite_PPIase]]
+
|[[Media:Selected pplase assay data.xlsx|Sp18_TRwhite_PPIase]]
 
|-
 
|-
 
|Grey
 
|Grey
Line 207: Line 209:
 
|-
 
|-
 
|Orange
 
|Orange
|[[Media:Sp18_WForangePPIase.xls|Sp18_WForange_PPIase]]
+
|[[Media:Sp18_WForangePPIase2.xls|Sp18_WForange_PPIase]]
 
|-
 
|-
 
|Green
 
|Green
Line 232: Line 234:
  
  
TR DSF Raw Data<br>
+
'''TR DSF Raw Data'''<br>
 
[[Media:Sp18_TR_DSF_PlateMap.pdf|Sp18_TR_DSF_PlateMap]]<br>
 
[[Media:Sp18_TR_DSF_PlateMap.pdf|Sp18_TR_DSF_PlateMap]]<br>
 
[[Media:Sp18_TR_FKBP12_Melt Curve RFU Results.xlsx|Sp18_TR_FKBP12_Melt Curve RFU Results]]<br>
 
[[Media:Sp18_TR_FKBP12_Melt Curve RFU Results.xlsx|Sp18_TR_FKBP12_Melt Curve RFU Results]]<br>
 
[[Media:Sp18_TR_FKBP12_Melt Curve Derivative Results.xlsx|Sp18_TR_FKBP12_Melt Curve Derivative Results]]<br>
 
[[Media:Sp18_TR_FKBP12_Melt Curve Derivative Results.xlsx|Sp18_TR_FKBP12_Melt Curve Derivative Results]]<br>
  
WF DSF Raw Data<br>
+
'''WF DSF Raw Data'''<br>
 
[[Media:Sp18_WF_DSF_PlateMap.pdf|Sp18_WF_DSF_PlateMap]]<br>
 
[[Media:Sp18_WF_DSF_PlateMap.pdf|Sp18_WF_DSF_PlateMap]]<br>
 
[[Media:Sp18_WF_FKBP12_Melt Curve RFU Results.xlsx|Sp18_WF_FKBP12_Melt Curve RFU Results]]<br>
 
[[Media:Sp18_WF_FKBP12_Melt Curve RFU Results.xlsx|Sp18_WF_FKBP12_Melt Curve RFU Results]]<br>
Line 245: Line 247:
  
  
[[Media:Sp18_CombinedFKBP12Rapamycin_derivative.pdf|Excel file combining DSF derivative data FKBP12 with different concentrations of Rapamycin]]<br>
+
[[Media:Sp18_CombinedFKBP12Rapamycin_derivative2.xlsx|Excel file combining DSF derivative data FKBP12 with different concentrations of Rapamycin]]<br>
 
<br>
 
<br>
 
<br>
 
<br>
 
<br>
 
<br>
 
<br>
 
<br>
 
 
 
 
{| border=1px
 
{| border=1px
 
|'''Team'''
 
|'''Team'''
Line 260: Line 259:
 
|-
 
|-
 
|Red
 
|Red
|[[Media:Sp18_TRredDSF.xls|Sp18_TRred_DSF]]
+
|[[Media:Sp18_TRRed_FKBP12_Melt_Curve_Derivative_Results.xlsx|Sp18_TRred_DSF]]
 
|-
 
|-
 
|Orange
 
|Orange
Line 266: Line 265:
 
|-
 
|-
 
|Yellow
 
|Yellow
|[[Media:Sp18_TRyellowDSF.xls|Sp18_TRyellow_DSF]]
+
|[[Media:Sp18_TRyellow_DSF.xlsx|Sp18_TRyellow_DSF]]
 
|-
 
|-
 
|Green
 
|Green
|[[Media:Sp18_TRgreenDSF..xls|Sp18_TRgreen_DSF.]]
+
|[[Media:T-T Green Team DSF Sprint 18.xlsx|Sp18_TRgreen_DSF.]]
 
|-
 
|-
 
|Blue
 
|Blue
Line 278: Line 277:
 
|-
 
|-
 
|Purple
 
|Purple
|[[Media:Sp18_TRpurpleDSF.xls|Sp18_TRpurple_DSF]]
+
|[[Media:M1D6 DSF.xlsx|Sp18_TRpurple_DSF]]
 
|-
 
|-
 
|White
 
|White
|[[Media:Sp18_TRwhiteDSF.xls|Sp18_TRwhite_DSF]]
+
|[[Media:TR White DSF MeltingTemps Graphs 3.xlsx|Sp18_TRwhite_DSF]]
 
|-
 
|-
 
|Grey
 
|Grey
Line 310: Line 309:
 
|-
 
|-
 
|}
 
|}
 
  
 
==Module 2: Measuring gene expression==
 
==Module 2: Measuring gene expression==
 +
{| border=1px
 +
|'''Team'''
 +
|'''qPCR Results'''
 +
|'''Melt Curve Derivative'''
 +
|-
 +
|colspan=3|'''T/R'''
 +
|-
 +
|Red
 +
|[[Media:Sp18_TRred_qPCR.xlsx|Sp18_TRred_qPCR]]
 +
|[[Media:Sp18_TRred_Tm.jpg|Sp18_TRred_Tm.jpg]]
 +
|-
 +
|Orange
 +
|[[Media:Sp18_TRorange_qPCR.xlsx|Sp18_TRorange_qPCR]]
 +
|[[Media:Sp18_TRorange_Tm.jpg|Sp18_TRorange_Tm.jpg]]
 +
|-
 +
|Yellow
 +
|[[Media:Sp18_TRyellow_qPCR.xlsx|Sp18_TRyellow_qPCR]]
 +
|[[Media:Sp18_TRyellow_Tm.jpg|Sp18_TRyellow_Tm.jpg]]
 +
|-
 +
|Green
 +
|[[Media:Sp18_TRgreen_qPCR.xlsx|Sp18_TRgreen_qPCR]]
 +
|[[Media:Sp18_TRgreen_Tm.jpg|Sp18_TRgreen_Tm.jpg]]
 +
|-
 +
|Blue
 +
|[[Media:Sp18_TRblue_qPCR.xlsx|Sp18_TRblue_qPCR]]
 +
|[[Media:Sp18_TRblue_Tm.jpg|Sp18_TRblue_Tm.jpg]]
 +
|-
 +
|Pink
 +
|[[Media:Sp18_TRpink_qPCR.xlsx| Sp18_TRpink_qPCR]]
 +
|[[Media:Sp18_TRpink_Tm.jpg|Sp18_TRpink_Tm.jpg]]
 +
|-
 +
|Purple
 +
|[[Media:Sp18_TRpurple_qPCR.xlsx|Sp18_TRpurple_qPCR]]
 +
|[[Media:Sp18_TRpurple_Tm.jpg|Sp18_TRpurple_Tm.jpg]]
 +
|-
 +
|White
 +
|[[Media:Sp18_TRwhite_qPCR.xlsx|Sp18_TRwhite_qPCR]]
 +
|[[Media:Sp18_TRwhite_Tm.jpg|Sp18_TRwhite_Tm.jpg]]
 +
|-
 +
|Grey
 +
|[[Media:Sp18_TRgrey_qPCR.xlsx|Sp18_TRgrey_qPCR]]
 +
|[[Media:Sp18_TRgrey_Tm.jpg|Sp18_TRgrey_Tm.jpg]]
 +
|-
 +
|colspan=3|'''W/F'''
 +
|-
 +
|Red
 +
|[[Media:Sp18_WFred_qPCR.xlsx|Sp18_WFred_qPCR]]
 +
|[[Media:Sp18_WFred_Tm.jpg|Sp18_WFred_Tm.jpg]]
 +
|-
 +
|Orange
 +
|[[Media:Sp18_WForange_qPCR.xlsx|Sp18_WForange_qPCR]]
 +
|[[Media:Sp18_WForange_Tm.jpg|Sp18_WForange_Tm.jpg]]
 +
|-
 +
|Green
 +
|[[Media:Sp18_WFyellow_qPCR.xlsx|Sp18_WFgreen_qPCR]]
 +
|[[Media:Sp18_WFgreen_Tm.jpg|Sp18_WFgreen_Tm.jpg]]
 +
|-
 +
|Blue
 +
|[[Media:Sp18_WFblue_qPCR.xlsx|Sp18_WFblue_qPCR]]
 +
|[[Media:Sp18_WFblue_Tm.jpg|Sp18_WFblue_Tm.jpg]]
 +
|-
 +
|Pink
 +
|[[Media:Sp18_WFpink_qPCR.xlsx|Sp18_WFpink_qPCR]]
 +
|[[Media:Sp18_WFpink_Tm.jpg|Sp18_WFpink_Tm.jpg]]
 +
|-
 +
|Purple
 +
|[[Media:Sp18_WFpurple_qPCR.xlsx|Sp18_WFpurple_qPCR]]
 +
|[[Media:Sp18_WFpurple_Tm.jpg|Sp18_WFpurple_Tm.jpg]]
 +
|-
 +
|Gray
 +
|[[Media:Sp18_WFplatinum_qPCR.xlsx|Sp18_WFplatinum_qPCR]]
 +
|[[Media:Sp18_WFplatinum_Tm.jpg|Sp18_WFplatinum_Tm.jpg]]
 +
|-
 +
|}
 +
<br>
 +
{| border=1px
 +
|'''Teams'''
 +
|'''qPCR p21 Forward Primer Sequence'''
 +
|'''qPCR p21 Reverse Primer Sequence'''
 +
|-
 +
|colspan=3|'''T/R'''
 +
|-
 +
|Red, Green, Blue, Purple
 +
|AGTCAGTTCCTTGTGGAGCC
 +
|GACATGGCGCCTCCTCTG
 +
|-
 +
|Orange, Yellow, White
 +
|GCCGAAGTCAGTTCCTTGTG
 +
|TTCTGACATGGCGCCTCCT
 +
|-
 +
|Pink
 +
|GTCAGTTCCTTGTGGAGCCG
 +
|ATGGCGCCTCCTCTGAGT
 +
|-
 +
|Gray
 +
|GCTGCCGAAGTCAGTTCCTT
 +
|TTCTGACATGGCGCCTCC
 +
|-
 +
|colspan=3|'''W/F'''
 +
|-
 +
|Red
 +
|CCAGCATGACAGATTTCTACCAC
 +
|CTTCCTGTGGGCGGATTAGG
 +
|-
 +
|Orange, Pink, Purple, Platinum
 +
|GCAGACCAGCATGACAGATTTC
 +
|ATGTAGAGCGGGCCTTTGAG
 +
|-
 +
|Green, Blue
 +
|GGCAGACCAGCATGACAGATTT
 +
|AGATGTAGAGCGGGCCTTTG
 +
|}
  
===M2D9: Cell viability data===
+
 
 +
===M2D9 Cell viability data===
 +
[[Media:Sp18_M2_TR_CTG.xlsx|Sp18 TR Cell Titer Glo Data]]<br>
 +
[[Media:Sp18_M2_WF_CTG.xlsx|Sp18 WF Cell Titer Glo Data]]<br>
 +
[[Image:Sp18_DrugSignUps.png|thumb|left|350px]]
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
  
 
==Module 3: Engineering biomaterials==
 
==Module 3: Engineering biomaterials==
 +
===TEM & EDX Images===
 +
[[Media:Sp18_GoldStandard.zip|Gold standard images--only one set taken for the whole class to use]]<br>
 +
 +
===Battery Capacity Measurements===
 +
Please use data that were sent to you via email.
 +
 +
===T/R Battery Information===
 +
 +
{| border=1px
 +
|'''Team'''
 +
|'''Experimental battery composition'''
 +
|'''Weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|red
 +
|5nm gold, 25 per phage
 +
|3.06
 +
|108.81
 +
|-
 +
|orange
 +
|3.8nm gold, 60 per phage
 +
|4.7
 +
|81.4
 +
|-
 +
|yellow
 +
|9nm gold, 5 per phage
 +
|2.54
 +
|130.50
 +
|-
 +
|green
 +
|9nm gold, 7 per phage
 +
|2.50
 +
|47.2
 +
|-
 +
|blue
 +
|9nm gold, 15 per phage
 +
|3.74
 +
|78.83
 +
|-
 +
|pink
 +
|3.8nm gold, 60 per phage
 +
|
 +
|
 +
|-
 +
|purple
 +
|3.8nm gold, 60 per phage
 +
|3.24
 +
|91.45
 +
|-
 +
|gray
 +
|5nm gold, 60 per phage
 +
|2.91
 +
|
 +
|-
 +
|white
 +
|5nm gold, ~60 per phage
 +
|3.17
 +
| 111.33
 +
|}
 +
<br>
 +
{| border=1px
 +
|'''Team'''
 +
|'''Gold standard battery weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|red
 +
|3.43
 +
|96.64
 +
|-
 +
|orange
 +
|1.29
 +
|87.4
 +
|-
 +
|yellow
 +
|2.98
 +
|60.28
 +
|-
 +
|green
 +
|3.47
 +
|46.69
 +
|-
 +
|blue
 +
|3.05
 +
|58.43
 +
|-
 +
|pink
 +
|
 +
|
 +
|-
 +
|purple
 +
|2.27
 +
|62.98
 +
|-
 +
|gray
 +
|2.12
 +
|
 +
|-
 +
|white
 +
|
 +
|
 +
|}
 +
<br>
 +
<br>
 +
 +
===W/F Battery Information===
 +
{| border=1px
 +
|'''Team'''
 +
|'''Experimental battery composition'''
 +
|'''Weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|red
 +
|9nm, 20 per phage
 +
|
 +
|
 +
|-
 +
|orange
 +
|5nm, 17 per phage
 +
|
 +
|
 +
|-
 +
|green
 +
|5nm, 30 per phage
 +
|N/A
 +
|N/A
 +
|-
 +
|blue
 +
|3.8nm, 30 per phage; 5nm, 10 per phage
 +
|N/A
 +
|N/A
 +
|-
 +
|pink
 +
|9nm, 17 per phage
 +
|N/A
 +
|N/A
 +
|-
 +
|purple
 +
|5nm, 18 per phage
 +
|3.005
 +
|38.30269
 +
|-
 +
|platinum
 +
|3.8nm, 20 per phage; 5nm, 12 per phage; 9nm, 8 per phage
 +
|N/A
 +
|N/A
 +
|}
 +
<br>
 +
{| border=1px
 +
|'''Team'''
 +
|'''Gold standard battery weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|red
 +
|3.34
 +
|86.38279
 +
|-
 +
|orange
 +
|2.76
 +
|106.6828
 +
|-
 +
|green
 +
|
 +
|
 +
|-
 +
|blue
 +
|
 +
|
 +
|-
 +
|pink
 +
|3.91
 +
|99.46007
 +
|-
 +
|purple
 +
|
 +
|
 +
|-
 +
|platinum
 +
|2.98
 +
|37.91946
 +
|}

Latest revision as of 10:06, 14 May 2018

20.109(S18): Laboratory Fundamentals of Biological Engineering

Sp18 banner image v2.png

Spring 2018 schedule        FYI        Assignments        Homework        Class data        Communication
       1. Assessing ligand binding        2. Measuring gene expression        3. Engineering biomaterials              


Module 1: Assessing ligand binding

M1D2: SMM analysis

GAL files linked here.

Scan images and set numbers assigned to each team:

Team Slide #1 Slide #2
T/R
Red 14399983, set 1 14400077, set 4
Orange 14400113, set 2 14400139, set 3
Yellow 14400114, set 2 14400140, set 3
Green 14399984, set 5 14399988, set 6
Blue 14400072, set 5 14399987, set 6
Pink 14399983, set 1 14400128, set 7
Purple 14400077, set 4 14399959, set 8
White 14400129, set 7 14400081, set 9
Grey 14400128, set 7 14399959, set 8
W/F
Red 14400129, set 7 14400081, set 9
Orange 14400128, set 7 14399959, set 8
Green 14400143, set 11 14399950, set 12
Blue 14400147, set 10 14399951, set 12
Pink 14400146, set 10 14399947, set 11
Purple 14399983, set 1 14400077, set 4
White 14400113, set 2 14400139, set 3


Chosen Compounds

List of Chosen Compounds
List of Compounds with SMILES
List of Compounds with SMILES and Teams

M1D4: Protein Gel Images

Team gel image
T/R
Red Sp18_TRred
Orange Sp18_TRorange
Yellow Sp18_TRyellow
Green Sp18_TRgreen
Blue Sp18_TRblue
Pink Sp18_TRpink
Purple Sp18_TRpurple
White Sp18_TRwhite
Grey Sp18_TRgrey
W/F
Red Sp18_WFred
Orange Sp18_WForange
Green Sp18_WFgreen
Blue Sp18_WFblue
Pink Sp18_WFpink
Purple Sp18_WFpurple
Gray Sp18_WFgray


M1D5: PPIase Assay Results

TR Raw Data
Sp18_PPIase_TR_Run1
Sp18_PPIase_TR_Run2
Sp18_PPIase_TR_Run3

WF Raw Data
Sp18_PPIase_WF_Run1
Sp18_PPIase_WF_Run2
Sp18_PPIase_WF_Run3

Pooled PPIase Data
TR & WF pooled Conditions #1, #2, #3, #6, and #7


Team PPIase Assay Results
T/R
Red Sp18_TRred_PPIase
Orange Sp18_TRorange_PPIase
Yellow Sp18_TRyellow_PPIase
Green Sp18_TRgreen_PPIase
Blue Sp18_TRblue_PPIase
Pink Sp18_TRpink_PPIase
Purple Sp18_TRpurple_PPIase
White Sp18_TRwhite_PPIase
Grey Sp18_TRgrey_PPIase
W/F
Red Sp18_WFred_PPIase
Orange Sp18_WForange_PPIase
Green Sp18_WFgreen_PPIase
Blue Sp18_WFblue_PPIase
Pink Sp18_WFpink_PPIase
Purple Sp18_WFpurple_PPIase
Gray Sp18_WFgray_PPIase

M1D6: DSF Assay Results

Rapamycin Concentrations

Sp18 rapamycinconcentratoins.png


TR DSF Raw Data
Sp18_TR_DSF_PlateMap
Sp18_TR_FKBP12_Melt Curve RFU Results
Sp18_TR_FKBP12_Melt Curve Derivative Results

WF DSF Raw Data
Sp18_WF_DSF_PlateMap
Sp18_WF_FKBP12_Melt Curve RFU Results
Sp18_WF_FKBP12_Melt Curve Derivative Results



Excel file combining DSF derivative data FKBP12 with different concentrations of Rapamycin




Team DSF Assay Results
T/R
Red Sp18_TRred_DSF
Orange Sp18_TRorange_DSF
Yellow Sp18_TRyellow_DSF
Green Sp18_TRgreen_DSF.
Blue Sp18_TRblue_DSF.
Pink Sp18_TRpink_DSF
Purple Sp18_TRpurple_DSF
White Sp18_TRwhite_DSF
Grey Sp18_TRgrey_DSF
W/F
Red Sp18_WFred_DSF
Orange Sp18_WForange_DSF
Green Sp18_WFgreen_DSF
Blue Sp18_WFblue_DSF
Pink Sp18_WFpink_DSF
Purple Sp18_WFpurple_DSF
Gray Sp18_WFgray_DSF

Module 2: Measuring gene expression

Team qPCR Results Melt Curve Derivative
T/R
Red Sp18_TRred_qPCR Sp18_TRred_Tm.jpg
Orange Sp18_TRorange_qPCR Sp18_TRorange_Tm.jpg
Yellow Sp18_TRyellow_qPCR Sp18_TRyellow_Tm.jpg
Green Sp18_TRgreen_qPCR Sp18_TRgreen_Tm.jpg
Blue Sp18_TRblue_qPCR Sp18_TRblue_Tm.jpg
Pink Sp18_TRpink_qPCR Sp18_TRpink_Tm.jpg
Purple Sp18_TRpurple_qPCR Sp18_TRpurple_Tm.jpg
White Sp18_TRwhite_qPCR Sp18_TRwhite_Tm.jpg
Grey Sp18_TRgrey_qPCR Sp18_TRgrey_Tm.jpg
W/F
Red Sp18_WFred_qPCR Sp18_WFred_Tm.jpg
Orange Sp18_WForange_qPCR Sp18_WForange_Tm.jpg
Green Sp18_WFgreen_qPCR Sp18_WFgreen_Tm.jpg
Blue Sp18_WFblue_qPCR Sp18_WFblue_Tm.jpg
Pink Sp18_WFpink_qPCR Sp18_WFpink_Tm.jpg
Purple Sp18_WFpurple_qPCR Sp18_WFpurple_Tm.jpg
Gray Sp18_WFplatinum_qPCR Sp18_WFplatinum_Tm.jpg


Teams qPCR p21 Forward Primer Sequence qPCR p21 Reverse Primer Sequence
T/R
Red, Green, Blue, Purple AGTCAGTTCCTTGTGGAGCC GACATGGCGCCTCCTCTG
Orange, Yellow, White GCCGAAGTCAGTTCCTTGTG TTCTGACATGGCGCCTCCT
Pink GTCAGTTCCTTGTGGAGCCG ATGGCGCCTCCTCTGAGT
Gray GCTGCCGAAGTCAGTTCCTT TTCTGACATGGCGCCTCC
W/F
Red CCAGCATGACAGATTTCTACCAC CTTCCTGTGGGCGGATTAGG
Orange, Pink, Purple, Platinum GCAGACCAGCATGACAGATTTC ATGTAGAGCGGGCCTTTGAG
Green, Blue GGCAGACCAGCATGACAGATTT AGATGTAGAGCGGGCCTTTG


M2D9 Cell viability data

Sp18 TR Cell Titer Glo Data
Sp18 WF Cell Titer Glo Data

Sp18 DrugSignUps.png




















Module 3: Engineering biomaterials

TEM & EDX Images

Gold standard images--only one set taken for the whole class to use

Battery Capacity Measurements

Please use data that were sent to you via email.

T/R Battery Information

Team Experimental battery composition Weight of cathode (mg) Actual capacity (mA*h/g)
red 5nm gold, 25 per phage 3.06 108.81
orange 3.8nm gold, 60 per phage 4.7 81.4
yellow 9nm gold, 5 per phage 2.54 130.50
green 9nm gold, 7 per phage 2.50 47.2
blue 9nm gold, 15 per phage 3.74 78.83
pink 3.8nm gold, 60 per phage
purple 3.8nm gold, 60 per phage 3.24 91.45
gray 5nm gold, 60 per phage 2.91
white 5nm gold, ~60 per phage 3.17 111.33


Team Gold standard battery weight of cathode (mg) Actual capacity (mA*h/g)
red 3.43 96.64
orange 1.29 87.4
yellow 2.98 60.28
green 3.47 46.69
blue 3.05 58.43
pink
purple 2.27 62.98
gray 2.12
white



W/F Battery Information

Team Experimental battery composition Weight of cathode (mg) Actual capacity (mA*h/g)
red 9nm, 20 per phage
orange 5nm, 17 per phage
green 5nm, 30 per phage N/A N/A
blue 3.8nm, 30 per phage; 5nm, 10 per phage N/A N/A
pink 9nm, 17 per phage N/A N/A
purple 5nm, 18 per phage 3.005 38.30269
platinum 3.8nm, 20 per phage; 5nm, 12 per phage; 9nm, 8 per phage N/A N/A


Team Gold standard battery weight of cathode (mg) Actual capacity (mA*h/g)
red 3.34 86.38279
orange 2.76 106.6828
green
blue
pink 3.91 99.46007
purple
platinum 2.98 37.91946