Difference between revisions of "20.109(F18):Class data"
From Course Wiki
(→TR Battery information) |
(→TR Battery information) |
||
(13 intermediate revisions by 9 users not shown) | |||
Line 279: | Line 279: | ||
|- | |- | ||
|Red | |Red | ||
− | | | + | | 25 |
− | | | + | | 2.15 |
− | | | + | | 44.0999 |
|- | |- | ||
|Orange | |Orange | ||
|10 | |10 | ||
|2.87 | |2.87 | ||
− | | | + | |20.2247191 |
|- | |- | ||
|Green | |Green | ||
Line 294: | Line 294: | ||
|- | |- | ||
|Pink | |Pink | ||
− | | | + | |35 |
− | | | + | |1.55 |
− | | | + | |29.39068 |
|- | |- | ||
|Purple | |Purple | ||
− | | | + | |18 |
− | | | + | |1.71 |
− | | | + | |42.12692 |
+ | |- | ||
+ | |Yellow | ||
+ | |20 | ||
+ | |2.2 | ||
+ | |21.1 | ||
|} | |} | ||
Line 312: | Line 317: | ||
|- | |- | ||
|Yellow | |Yellow | ||
− | | | + | |20 |
− | | | + | |1.93 |
− | | | + | |123.296872 |
|- | |- | ||
|Green | |Green | ||
− | | | + | |20 |
− | | | + | |2.59 |
− | | | + | |88.94609 |
|- | |- | ||
|Blue | |Blue | ||
− | | | + | | 40 |
− | | | + | | 3.1 |
− | | | + | | 89.00836 |
|} | |} |
Latest revision as of 17:43, 7 May 2019
Contents
Module 1
Cell Loading Data
CometChip Data
Team | Analyzed Data |
T/R red | Analyzed CometChip data |
T/R orange | Analyzed CometChip data |
T/R green | Analyzed CometChip data |
T/R pink | Analyzed CometChip data |
T/R purple | Analyzed CometChip data |
Team | Analyzed Data |
W/F yellow | Analyzed CometChip data |
W/F green | Analyzed CometChip data |
W/F blue | Analyzed CometChip data |
W/F pink | Analyzed CometChip data |
gamma-H2AX Data
Team | Recovery time (min) | Raw gamma-H2AX Data | Analyzed gamma-H2AX Data |
T/R red | 30 | raw data | analyzed data |
T/R orange | 30 | raw data | analyzed data |
T/R green | 30 | raw data | analyzed data |
T/R pink | 30 | raw data | analyzed data |
T/R purple | 60 | raw data | analyzed data |
Team | Recovery time (min) | Raw gamma-H2AX Data | Analyzed gamma-H2AX Data |
W/F yellow | 30 | raw data | analyzed data |
W/F green | 30 | raw data | analyzed data |
W/F blue | 60 | raw data | analyzed data |
W/F pink | 30 | raw data | analyzed data |
Module 2
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR red | E | pta | TGCGCCCGATCAGACTACGACTATC | Coding region | template | File:TRRed ethanol rawdata.xlsx |
TR orange | E | ldhA | gttgcaggtacttcttgtcgt | 32 bps downstream from start of gene | Nontemplate Strand | File:TROrange ethanol rawdata.xlsx |
TR green | A | adhE | TACTAAAAAAGTTTAACATTATCA | locus targeted: -34 upstream (promoter) | Template strand | File:TRGreen acetate rawdata.xlsx |
TR pink | A | Citrate Synthase (gltA) | tgagttttgcttttgtatcagccat | Beginning of gene | Non-template Strand | File:TRPink acetate rawdata.xlsx |
TR purple | A | ldhA | TAGTAGCTTAAATGTGATTCAACAT | Locus targeted: -40 upstream region (promoter) | Non-template strand | File:TRPurple acetate rawdata.xlsx |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF yellow | A | adhE | ATTCGAGCAGATGATTTACTAAAAA | locus targeted: -50 upstream; promoter | template strand | File:WFyellow Acetate RawData.xlsx |
WF green | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | locus targeted: -35 upstream (promoter) | template strand | File:WFGreen Acetate RawData.xlsx |
WF blue | A | adhE | TTCGAGCAGATGATTTACTAAA | locus targeted: -49 upstream (promoter) | Template Strand | File:WFBlue Acetate RawData.xlsx |
gRNA_target Sequencing Results
T/R
Team | pgRNA sequencing |
red | files |
orange | files |
green | files |
pink | files |
purple | files |
W/F
Team | pgRNA sequencing |
yellow | files |
green | files |
blue | files |
Module 3
Battery Capacity Raw Data
No-gold battery data
No gold control TEM and EDX images
Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
0 | 2.15 mg | 95.09 |
0 | 2.37 mg | 89.47 |
TR Battery information
Team | Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
Red | 25 | 2.15 | 44.0999 |
Orange | 10 | 2.87 | 20.2247191 |
Green | 23 | 3.88 | 85.67201222 |
Pink | 35 | 1.55 | 29.39068 |
Purple | 18 | 1.71 | 42.12692 |
Yellow | 20 | 2.2 | 21.1 |
WF Battery information
Team | Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
Yellow | 20 | 1.93 | 123.296872 |
Green | 20 | 2.59 | 88.94609 |
Blue | 40 | 3.1 | 89.00836 |