Difference between revisions of "Talk:20.109(F17):Module 2"
From Course Wiki
Line 98: | Line 98: | ||
| | | | ||
| | | | ||
+ | |} | ||
+ | ===M2D5/M2D7: sequencing data=== | ||
+ | |||
+ | ====T/R==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''pgRNA sequencing''' | ||
+ | |- | ||
+ | |yellow | ||
+ | |[[Media:TR Yellow.zip| files]] | ||
+ | |- | ||
+ | |green | ||
+ | |[[Media:TR Green.zip| files]] | ||
+ | |- | ||
+ | |blue | ||
+ | |[[Media:TR Blue.zip| files]] | ||
+ | |- | ||
+ | |pink | ||
+ | |[[Media:TR Pink.zip| files]] | ||
+ | |- | ||
+ | |purple | ||
+ | |[[Media:TR Purple.zip| files]] | ||
+ | |} | ||
+ | |||
+ | ====W/F==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''pgRNA sequencing''' | ||
+ | |- | ||
+ | |red | ||
+ | |[[Media:WFred_sequencing.zip| files]] | ||
+ | |- | ||
+ | |green | ||
+ | |[[Media:WFgreen_sequencing.zip| files]] | ||
+ | |- | ||
+ | |blue | ||
+ | |[[Media:WFblue_sequencing.zip| files]] | ||
+ | |- | ||
+ | |purple | ||
+ | |[[Media:WFpurple_sequencing.zip| files]] | ||
+ | |- | ||
+ | |instructors | ||
+ | |[[Media:Instructors_ackB.zip| ackB files]] | ||
+ | |- | ||
+ | |instructors | ||
+ | |[[Media:Instructors_ldhA.zip| ldhA files]] | ||
|} | |} |
Revision as of 14:41, 2 November 2017
Contents
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Acetate | adhE | TTAACGCACTCGTAGAGCGTGTAAA | ||
orange | Ethanol | pta-ack | CTATGGCTCCCTGACGTTTT | ||
yellow | Ethanol | frdA | GCTGTGGGATAAAAACAATCTGGAG | ||
green | E | LdhA | ttgtgctataaacggcgagtttcat | ||
blue | E | pta | ttcacgacaacgttcaataatcat | ||
pink | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | ||
purple | Acetate | adhE | TTTACTAAAAAAGTTTAACATTATC | ||
white | Acetate | adhE | CTGATAATGTTAAACTTTTT |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Ethanol | ack (indirectly, pta) | GTTTTTTTAGCCACGTATCAATTAT | ||
orange | Ethanol | ldhA | ATTCAACATCACTGGAGAAAGTCTT | ||
blue | Ethanol | ackA | TTTTTAGCCACGTATCAATTAT |
M2D5/M2D7: sequencing data
T/R
Team | pgRNA sequencing |
yellow | files |
green | files |
blue | files |
pink | files |
purple | files |
W/F
Team | pgRNA sequencing |
red | files |
green | files |
blue | files |
purple | files |
instructors | ackB files |
instructors | ldhA files |