Talk:20.109(F17):Module 2

Team	Ethanol (E) or Acetate (A)	Gene targeted by CRISPRi gRNA	gRNA sequence (without tag at 3' end)	Locus targeted (eg. beginning of gene, putative promoter, -35 region)	Target template or nontemplate strand
red	Acetate	adhE	TTAACGCACTCGTAGAGCGTGTAAA	beginning of coding region	non-template
orange	Ethanol	pta-ack	CTATGGCTCCCTGACGTTTT	promoter region	template strand
yellow	Ethanol	frdA	GCTGTGGGATAAAAACAATCTGGAG	minus 35 region	template strand
green	E	LdhA	ttgtgctataaacggcgagtttcat	The middle of the gene	Non template strand
blue	E	pta	ttcacgacaacgttcaataatcat	coding region	non-template strand
pink	Acetate	adhE	TTACTAAAAAAGTTTAACATTATCA	promoter region	template strand
purple	Acetate	adhE	TTTACTAAAAAAGTTTAACATTATC	' -35 region'	'template'
white	Acetate	adhE	CTGATAATGTTAAACTTTTT	promoter	non-template strand

Team	Ethanol (E) or Acetate (A)	Gene targeted by CRISPRi gRNA	gRNA sequence (without tag at 3' end)	Locus targeted (eg. beginning of gene, putative promoter, -35 region)	Target template or nontemplate strand
red	Ethanol	ack (indirectly, pta)	GTTTTTTTAGCCACGTATCAATTAT	promoter region of ack	Nontemplate strand
orange	Ethanol	ldhA	ATTCAACATCACTGGAGAAAGTCTT	promoter	template
blue	Ethanol	ackA	TTTTTAGCCACGTATCAATTAT	promoter region of ackA, starting at -32	nontemplate

Team	Ethanol (E) or Acetate (A)	Gene targeted by CRISPRi gRNA	gRNA sequence (without tag at 3' end)	Locus targeted (eg. beginning of gene, putative promoter, -35 region)	Target template or nontemplate strand
Instructor	Acetate	aceEF	GGAATAACCCatgtcagaacgtttc	5' UTR region and beginning of coding region	Template
Instructor	Acetate	adhE	AATGCTCTCCTGATAATGTTAAAC	Promoter and 5' UTR region right before coding region	Nontemplate

Contents