Difference between revisions of "20.109(F19):Class data"

From Course Wiki
Jump to: navigation, search
(M1D6)
(Module 1: Measuring genomic instability)
 
(54 intermediate revisions by 13 users not shown)
Line 30: Line 30:
 
|[[Media:Purple_Team_Data.xlsx|Purple Team Data]]
 
|[[Media:Purple_Team_Data.xlsx|Purple Team Data]]
 
|-
 
|-
| WF Team
+
| WF Cyan
 
|[[Media:Fa19 M1H2AX analyzed templateV2 WF.xlsx | WF Team Data]]
 
|[[Media:Fa19 M1H2AX analyzed templateV2 WF.xlsx | WF Team Data]]
 
|-
 
|-
Line 60: Line 60:
 
|[[Media: CometChip_Data_PurpleTeam.xlsx |Purple Team Data]]
 
|[[Media: CometChip_Data_PurpleTeam.xlsx |Purple Team Data]]
 
|-
 
|-
| WF Team
+
| WF Cyan
 
| [[Media:CometChip Data WF.xlsx | WF Team Data]]
 
| [[Media:CometChip Data WF.xlsx | WF Team Data]]
 
|-
 
|-
 
|}
 
|}
 +
 +
===Fermentation product and gene targeted:===
 +
 +
====T/R====
 +
 +
{| border=1px
 +
|'''Team'''
 +
|'''Ethanol (E) or Acetate (A)'''
 +
|'''Gene targeted by CRISPRi gRNA'''
 +
|'''gRNA (DNA) sequence (without tag at 3' end)'''
 +
|'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)'''
 +
|'''Target template or nontemplate strand'''
 +
|'''Colorimetric Assay Results'''
 +
|-
 +
|TR orange
 +
| E
 +
| ldhA
 +
| GTACTGTTTTGTGCTATAAA
 +
| Coding region
 +
| Non-template
 +
|[[Media: M2ColorimetricAssay_TROrange.xlsx | Orange Team Data ]]
 +
|-
 +
|TR yellow
 +
| E
 +
| ldhA
 +
| AAATTCCAGCTCAAAGCCAAAGG
 +
| Coding region
 +
| Non-template
 +
|[[Media: M2ColorimetricAssay_Yellow.xlsx| Yellow Team Data]]
 +
|-
 +
|TR green
 +
| E
 +
| ack
 +
| TTAGCCACGTATCAATTATAGG
 +
| Promoter Region
 +
|Template
 +
|[[Media: TRGreen.xlsx| Green Team Data]]
 +
|-
 +
|TR blue
 +
|A
 +
| adhE
 +
| ccagagcggcggcgcggaag
 +
| Coding region
 +
| Non-template
 +
|[[Media: Blue_M2ColorimetricAssay_Template.xlsx | Blue Team data ]]
 +
|-
 +
|TR pink
 +
| E
 +
| ppc
 +
| AGCATACTGACATTACTACGCAATG
 +
| Coding region
 +
| Non-Template
 +
|[[Media: DATA_mod_2.xlsx | Pink Team data ]]
 +
|-
 +
|TR purple
 +
| E
 +
| ldhA
 +
| CTTAAATGTGATTCAACATCACTGG
 +
| Promoter region
 +
| Template
 +
|[[Media:TRpurple_rawdata_ethanol.xlsx | Purple Team Data ]]
 +
|}
 +
 +
====W/F====
 +
 +
{| border=1px
 +
|'''Team'''
 +
|'''Ethanol (E) or Acetate (A)'''
 +
|'''Gene targeted by CRISPRi gRNA'''
 +
|'''gRNA (DNA) sequence (without tag at 3' end)'''
 +
|'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)'''
 +
|'''Target template or nontemplate strand'''
 +
|'''Colorimetric Assay Results'''
 +
|-
 +
|WF Cyan
 +
|  E
 +
|  frd
 +
|  GTGGGATAAAAACAATCTGG
 +
| promoter
 +
| Template
 +
|[[Media:Athena Nguyen frd WF.xlsx | WF FRD DATA ATHENA]]
 +
|-
 +
|WF Cyan
 +
| A
 +
| ppc
 +
| ACTGACATTACTACGCAATG
 +
| beginning of gene
 +
| Non-template
 +
|[[Media:M2ColorimetricAssay Acetate PPC WF.xlsx | WF PPC Data]]
 +
|-
 +
|WF Cyan
 +
| E
 +
| pta
 +
| TTTGTAACCCGCCAAATCGG
 +
| promoter
 +
| Template
 +
|[[Media:M2ColorimetricAssay Template.xlsx | WF pta data ]]
 +
|-
 +
|}
 +
[[File:TR_Yeloow_Western.xlsx]]

Latest revision as of 19:04, 3 December 2019

20.109(F19): Laboratory Fundamentals of Biological Engineering

Fa19 20109 Banner image.png

Fall 2019 schedule        FYI        Assignments        Homework        Class data        Communication
       1. Measuring genomic instability        2. Modulating metabolism        3. Testing chemical probes              

Module 1: Measuring genomic instability

M1D5

gamma-H2AX analysis

Team Upload, then link the completed excel spreadsheet from the wiki here!
TR Orange Orange Team Data
TR Yellow Yellow Team Data
TR Green Green Team Data
TR Blue Blue Team Data
TR Pink Pink Team Data
TR Purple Purple Team Data
WF Cyan WF Team Data

M1D6

Comet Chip analysis

Team
TR Orange Orange Team Data
TR Yellow Yellow Team Data
TR Green Green Team Data
TR Blue Blue Team Data
TR Pink Pink Team Data
TR Purple Purple Team Data
WF Cyan WF Team Data

Fermentation product and gene targeted:

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
TR orange E ldhA GTACTGTTTTGTGCTATAAA Coding region Non-template Orange Team Data
TR yellow E ldhA AAATTCCAGCTCAAAGCCAAAGG Coding region Non-template Yellow Team Data
TR green E ack TTAGCCACGTATCAATTATAGG Promoter Region Template Green Team Data
TR blue A adhE ccagagcggcggcgcggaag Coding region Non-template Blue Team data
TR pink E ppc AGCATACTGACATTACTACGCAATG Coding region Non-Template Pink Team data
TR purple E ldhA CTTAAATGTGATTCAACATCACTGG Promoter region Template Purple Team Data

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
WF Cyan E frd GTGGGATAAAAACAATCTGG promoter Template WF FRD DATA ATHENA
WF Cyan A ppc ACTGACATTACTACGCAATG beginning of gene Non-template WF PPC Data
WF Cyan E pta TTTGTAACCCGCCAAATCGG promoter Template WF pta data
File:TR Yeloow Western.xlsx