Difference between revisions of "20.109(F19):Class data"
From Course Wiki
Daniel Stein (Talk | contribs) (→T/R) |
(→Module 1: Measuring genomic instability) |
||
(10 intermediate revisions by 6 users not shown) | |||
Line 92: | Line 92: | ||
| Coding region | | Coding region | ||
| Non-template | | Non-template | ||
− | |[[Media: | + | |[[Media: M2ColorimetricAssay_Yellow.xlsx| Yellow Team Data]] |
|- | |- | ||
|TR green | |TR green | ||
Line 100: | Line 100: | ||
| Promoter Region | | Promoter Region | ||
|Template | |Template | ||
− | |[[Media: | + | |[[Media: TRGreen.xlsx| Green Team Data]] |
|- | |- | ||
|TR blue | |TR blue | ||
Line 116: | Line 116: | ||
| Coding region | | Coding region | ||
| Non-Template | | Non-Template | ||
− | |[[ | + | |[[Media: DATA_mod_2.xlsx | Pink Team data ]] |
|- | |- | ||
|TR purple | |TR purple | ||
Line 144: | Line 144: | ||
| promoter | | promoter | ||
| Template | | Template | ||
− | |[[ | + | |[[Media:Athena Nguyen frd WF.xlsx | WF FRD DATA ATHENA]] |
|- | |- | ||
|WF Cyan | |WF Cyan | ||
− | | | + | | A |
| ppc | | ppc | ||
| ACTGACATTACTACGCAATG | | ACTGACATTACTACGCAATG | ||
| beginning of gene | | beginning of gene | ||
| Non-template | | Non-template | ||
− | |[[ | + | |[[Media:M2ColorimetricAssay Acetate PPC WF.xlsx | WF PPC Data]] |
|- | |- | ||
|WF Cyan | |WF Cyan | ||
Line 160: | Line 160: | ||
| promoter | | promoter | ||
| Template | | Template | ||
− | |[[ | + | |[[Media:M2ColorimetricAssay Template.xlsx | WF pta data ]] |
|- | |- | ||
|} | |} | ||
+ | [[File:TR_Yeloow_Western.xlsx]] |
Latest revision as of 19:04, 3 December 2019
Contents
Module 1: Measuring genomic instability
M1D5
gamma-H2AX analysis
Team | Upload, then link the completed excel spreadsheet from the wiki here! |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Cyan | WF Team Data |
M1D6
Comet Chip analysis
Team | |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Cyan | WF Team Data |
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR orange | E | ldhA | GTACTGTTTTGTGCTATAAA | Coding region | Non-template | Orange Team Data |
TR yellow | E | ldhA | AAATTCCAGCTCAAAGCCAAAGG | Coding region | Non-template | Yellow Team Data |
TR green | E | ack | TTAGCCACGTATCAATTATAGG | Promoter Region | Template | Green Team Data |
TR blue | A | adhE | ccagagcggcggcgcggaag | Coding region | Non-template | Blue Team data |
TR pink | E | ppc | AGCATACTGACATTACTACGCAATG | Coding region | Non-Template | Pink Team data |
TR purple | E | ldhA | CTTAAATGTGATTCAACATCACTGG | Promoter region | Template | Purple Team Data |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF Cyan | E | frd | GTGGGATAAAAACAATCTGG | promoter | Template | WF FRD DATA ATHENA |
WF Cyan | A | ppc | ACTGACATTACTACGCAATG | beginning of gene | Non-template | WF PPC Data |
WF Cyan | E | pta | TTTGTAACCCGCCAAATCGG | promoter | Template | WF pta data |