Difference between revisions of "20.109(F19):Class data"
From Course Wiki
(→Fermentation product and gene targeted:) |
(→Module 1: Measuring genomic instability) |
||
(48 intermediate revisions by 13 users not shown) | |||
Line 30: | Line 30: | ||
|[[Media:Purple_Team_Data.xlsx|Purple Team Data]] | |[[Media:Purple_Team_Data.xlsx|Purple Team Data]] | ||
|- | |- | ||
− | | WF | + | | WF Cyan |
|[[Media:Fa19 M1H2AX analyzed templateV2 WF.xlsx | WF Team Data]] | |[[Media:Fa19 M1H2AX analyzed templateV2 WF.xlsx | WF Team Data]] | ||
|- | |- | ||
Line 60: | Line 60: | ||
|[[Media: CometChip_Data_PurpleTeam.xlsx |Purple Team Data]] | |[[Media: CometChip_Data_PurpleTeam.xlsx |Purple Team Data]] | ||
|- | |- | ||
− | | WF | + | | WF Cyan |
| [[Media:CometChip Data WF.xlsx | WF Team Data]] | | [[Media:CometChip Data WF.xlsx | WF Team Data]] | ||
|- | |- | ||
|} | |} | ||
+ | |||
===Fermentation product and gene targeted:=== | ===Fermentation product and gene targeted:=== | ||
Line 77: | Line 78: | ||
|'''Colorimetric Assay Results''' | |'''Colorimetric Assay Results''' | ||
|- | |- | ||
− | |TR | + | |TR orange |
| E | | E | ||
− | | | + | | ldhA |
− | | | + | | GTACTGTTTTGTGCTATAAA |
| Coding region | | Coding region | ||
− | | template | + | | Non-template |
− | |[[ | + | |[[Media: M2ColorimetricAssay_TROrange.xlsx | Orange Team Data ]] |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
|- | |- | ||
|TR yellow | |TR yellow | ||
− | | | + | | E |
− | | | + | | ldhA |
− | | | + | | AAATTCCAGCTCAAAGCCAAAGG |
− | | | + | | Coding region |
− | | | + | | Non-template |
− | |[[ | + | |[[Media: M2ColorimetricAssay_Yellow.xlsx| Yellow Team Data]] |
|- | |- | ||
|TR green | |TR green | ||
| E | | E | ||
− | | | + | | ack |
− | | | + | | TTAGCCACGTATCAATTATAGG |
− | | | + | | Promoter Region |
− | | | + | |Template |
− | |[[ | + | |[[Media: TRGreen.xlsx| Green Team Data]] |
|- | |- | ||
|TR blue | |TR blue | ||
− | | | + | |A |
| adhE | | adhE | ||
− | | | + | | ccagagcggcggcgcggaag |
− | | | + | | Coding region |
− | | | + | | Non-template |
− | |[[ | + | |[[Media: Blue_M2ColorimetricAssay_Template.xlsx | Blue Team data ]] |
|- | |- | ||
|TR pink | |TR pink | ||
− | | | + | | E |
− | | | + | | ppc |
− | | | + | | AGCATACTGACATTACTACGCAATG |
− | | | + | | Coding region |
− | | | + | | Non-Template |
− | |[[ | + | |[[Media: DATA_mod_2.xlsx | Pink Team data ]] |
|- | |- | ||
|TR purple | |TR purple | ||
− | | | + | | E |
− | | | + | | ldhA |
− | | | + | | CTTAAATGTGATTCAACATCACTGG |
− | | | + | | Promoter region |
− | | | + | | Template |
− | |[[ | + | |[[Media:TRpurple_rawdata_ethanol.xlsx | Purple Team Data ]] |
|} | |} | ||
Line 145: | Line 138: | ||
|'''Colorimetric Assay Results''' | |'''Colorimetric Assay Results''' | ||
|- | |- | ||
− | |WF | + | |WF Cyan |
− | | | + | | E |
− | | | + | | frd |
− | | | + | | GTGGGATAAAAACAATCTGG |
− | | | + | | promoter |
− | | | + | | Template |
− | |[[ | + | |[[Media:Athena Nguyen frd WF.xlsx | WF FRD DATA ATHENA]] |
+ | |- | ||
+ | |WF Cyan | ||
+ | | A | ||
+ | | ppc | ||
+ | | ACTGACATTACTACGCAATG | ||
+ | | beginning of gene | ||
+ | | Non-template | ||
+ | |[[Media:M2ColorimetricAssay Acetate PPC WF.xlsx | WF PPC Data]] | ||
+ | |- | ||
+ | |WF Cyan | ||
+ | | E | ||
+ | | pta | ||
+ | | TTTGTAACCCGCCAAATCGG | ||
+ | | promoter | ||
+ | | Template | ||
+ | |[[Media:M2ColorimetricAssay Template.xlsx | WF pta data ]] | ||
|- | |- | ||
|} | |} | ||
+ | [[File:TR_Yeloow_Western.xlsx]] |
Latest revision as of 19:04, 3 December 2019
Contents
Module 1: Measuring genomic instability
M1D5
gamma-H2AX analysis
Team | Upload, then link the completed excel spreadsheet from the wiki here! |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Cyan | WF Team Data |
M1D6
Comet Chip analysis
Team | |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Cyan | WF Team Data |
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR orange | E | ldhA | GTACTGTTTTGTGCTATAAA | Coding region | Non-template | Orange Team Data |
TR yellow | E | ldhA | AAATTCCAGCTCAAAGCCAAAGG | Coding region | Non-template | Yellow Team Data |
TR green | E | ack | TTAGCCACGTATCAATTATAGG | Promoter Region | Template | Green Team Data |
TR blue | A | adhE | ccagagcggcggcgcggaag | Coding region | Non-template | Blue Team data |
TR pink | E | ppc | AGCATACTGACATTACTACGCAATG | Coding region | Non-Template | Pink Team data |
TR purple | E | ldhA | CTTAAATGTGATTCAACATCACTGG | Promoter region | Template | Purple Team Data |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF Cyan | E | frd | GTGGGATAAAAACAATCTGG | promoter | Template | WF FRD DATA ATHENA |
WF Cyan | A | ppc | ACTGACATTACTACGCAATG | beginning of gene | Non-template | WF PPC Data |
WF Cyan | E | pta | TTTGTAACCCGCCAAATCGG | promoter | Template | WF pta data |