Difference between revisions of "Talk:20.109(F17):Module 2"
From Course Wiki
(→Fermentation product and gene targeted:) |
(→T/R) |
||
Line 43: | Line 43: | ||
|pta | |pta | ||
|ttcacgacaacgttcaataatcat | |ttcacgacaacgttcaataatcat | ||
− | | | + | |coding region |
− | | | + | |non-template strand |
|- | |- | ||
|pink | |pink |
Revision as of 18:44, 7 November 2017
Contents
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Acetate | adhE | TTAACGCACTCGTAGAGCGTGTAAA | beginning of coding region | |
orange | Ethanol | pta-ack | CTATGGCTCCCTGACGTTTT | ||
yellow | Ethanol | frdA | GCTGTGGGATAAAAACAATCTGGAG | minus 35 region | template strand |
green | E | LdhA | ttgtgctataaacggcgagtttcat | ||
blue | E | pta | ttcacgacaacgttcaataatcat | coding region | non-template strand |
pink | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | promoter region | template strand |
purple | Acetate | adhE | TTTACTAAAAAAGTTTAACATTATC | ' -35 region' | 'template' |
white | Acetate | adhE | CTGATAATGTTAAACTTTTT | promoter | non-template strand |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Ethanol | ack (indirectly, pta) | GTTTTTTTAGCCACGTATCAATTAT | promoter region of ack | Nontemplate strand |
orange | Ethanol | ldhA | ATTCAACATCACTGGAGAAAGTCTT | promoter | template |
blue | Ethanol | ackA | TTTTTAGCCACGTATCAATTAT | promoter region of ackA, starting at -32 | nontemplate |
Instructor Data
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
Instructor | Acetate | aceEF | GGAATAACCCatgtcagaacgtttc | 5' UTR region and beginning of coding region | Template |
Instructor | Acetate | adhE (1) | GGAGAGCATTatggctgttactaatg | 5' UTR region and beginning of coding region | Template |
Instructor | Acetate | adhE (2) | AATGCTCTCCTGATAATGTTAAAC | Promoter and 5' UTR region right before coding region | Nontemplate |
M2D5/M2D7: sequencing data
T/R
Team | pgRNA sequencing |
red | files |
orange | files |
yellow | files |
green | files |
blue | files |
pink | files |
purple | files |
white | files |
W/F
Team | pgRNA sequencing |
red | files |
orange | files |
blue | files |