Difference between revisions of "20.109(F19):Class data"

From Course Wiki
Jump to: navigation, search
(T/R)
(T/R)
Line 110: Line 110:
 
|-
 
|-
 
|TR blue
 
|TR blue
|E
+
|A
 
| adhE
 
| adhE
 
| ccagagcggcggcgcggaag
 
| ccagagcggcggcgcggaag

Revision as of 19:57, 10 October 2019

20.109(F19): Laboratory Fundamentals of Biological Engineering

Fa19 20109 Banner image.png

Fall 2019 schedule        FYI        Assignments        Homework        Class data        Communication
       1. Measuring genomic instability        2. Modulating metabolism        3. Testing chemical probes              

Module 1: Measuring genomic instability

M1D5

gamma-H2AX analysis

Team Upload, then link the completed excel spreadsheet from the wiki here!
TR Orange Orange Team Data
TR Yellow Yellow Team Data
TR Green Green Team Data
TR Blue Blue Team Data
TR Pink Pink Team Data
TR Purple Purple Team Data
WF Team WF Team Data

M1D6

Comet Chip analysis

Team
TR Orange Orange Team Data
TR Yellow Yellow Team Data
TR Green Green Team Data
TR Blue Blue Team Data
TR Pink Pink Team Data
TR Purple Purple Team Data
WF Team WF Team Data

Fermentation product and gene targeted:

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
TR example E pta ccagagcggcggcgcggaag Coding region Non-template [[File: | Raw data ]]
TR orange [[File: | Raw data ]]
TR yellow E ldhA AAATTCCAGCTCAAAGCCAAAGG Coding region Non-template [[File: | Raw data ]]
TR green E ack TTAGCCACGTATCAATTATAGG Promoter Region Template [[File: | Raw data ]]
TR blue A adhE ccagagcggcggcgcggaag Coding region Non-template [[File: | Raw data ]]
TR pink E ppc CATTGCGTAGTAATGTCAGTATGCT Coding region Template [[File: | Raw data ]]
TR purple E ldhA CTTAAATGTGATTCAACATCACTGG Promoter region Template [[File: | Raw data ]]

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
WF team [[File: | Raw data ]]