Difference between revisions of "20.109(F19):Class data"
From Course Wiki
Fidelia Gaba (Talk | contribs) (→M1D6) |
(→Module 1: Measuring genomic instability) |
||
(66 intermediate revisions by 14 users not shown) | |||
Line 30: | Line 30: | ||
|[[Media:Purple_Team_Data.xlsx|Purple Team Data]] | |[[Media:Purple_Team_Data.xlsx|Purple Team Data]] | ||
|- | |- | ||
− | | WF | + | | WF Cyan |
− | | | + | |[[Media:Fa19 M1H2AX analyzed templateV2 WF.xlsx | WF Team Data]] |
|- | |- | ||
|} | |} | ||
+ | |||
===M1D6=== | ===M1D6=== | ||
'''Comet Chip analysis'''<br> | '''Comet Chip analysis'''<br> | ||
Line 42: | Line 43: | ||
|- | |- | ||
| TR Orange | | TR Orange | ||
− | |[[Media: | + | |[[Media: CometChip Data Template.xlsx |Orange Team Data]] |
|- | |- | ||
| TR Yellow | | TR Yellow | ||
− | |[[Media: | + | |[[Media:TR Yellow Data.xlsx|Yellow Team Data]] |
|- | |- | ||
| TR Green | | TR Green | ||
− | |[[Media: |Green Team Data]] | + | |[[Media: GreenTeam_CometChip_Data.xlsx|Green Team Data]] |
|- | |- | ||
| TR Blue | | TR Blue | ||
− | |[[Media: | + | |[[Media: CometChip_Data_TRBlue.xlsx |Blue Team Data]] |
|- | |- | ||
| TR Pink | | TR Pink | ||
− | |[[Media: | + | |[[Media: PinkCometChip Data Template.xlsx |Pink Team Data]] |
|- | |- | ||
| TR Purple | | TR Purple | ||
− | |[[Media: |Purple Team Data]] | + | |[[Media: CometChip_Data_PurpleTeam.xlsx |Purple Team Data]] |
+ | |- | ||
+ | | WF Cyan | ||
+ | | [[Media:CometChip Data WF.xlsx | WF Team Data]] | ||
+ | |- | ||
+ | |} | ||
+ | |||
+ | ===Fermentation product and gene targeted:=== | ||
+ | |||
+ | ====T/R==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''Ethanol (E) or Acetate (A)''' | ||
+ | |'''Gene targeted by CRISPRi gRNA''' | ||
+ | |'''gRNA (DNA) sequence (without tag at 3' end)''' | ||
+ | |'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)''' | ||
+ | |'''Target template or nontemplate strand''' | ||
+ | |'''Colorimetric Assay Results''' | ||
+ | |- | ||
+ | |TR orange | ||
+ | | E | ||
+ | | ldhA | ||
+ | | GTACTGTTTTGTGCTATAAA | ||
+ | | Coding region | ||
+ | | Non-template | ||
+ | |[[Media: M2ColorimetricAssay_TROrange.xlsx | Orange Team Data ]] | ||
+ | |- | ||
+ | |TR yellow | ||
+ | | E | ||
+ | | ldhA | ||
+ | | AAATTCCAGCTCAAAGCCAAAGG | ||
+ | | Coding region | ||
+ | | Non-template | ||
+ | |[[Media: M2ColorimetricAssay_Yellow.xlsx| Yellow Team Data]] | ||
+ | |- | ||
+ | |TR green | ||
+ | | E | ||
+ | | ack | ||
+ | | TTAGCCACGTATCAATTATAGG | ||
+ | | Promoter Region | ||
+ | |Template | ||
+ | |[[Media: TRGreen.xlsx| Green Team Data]] | ||
+ | |- | ||
+ | |TR blue | ||
+ | |A | ||
+ | | adhE | ||
+ | | ccagagcggcggcgcggaag | ||
+ | | Coding region | ||
+ | | Non-template | ||
+ | |[[Media: Blue_M2ColorimetricAssay_Template.xlsx | Blue Team data ]] | ||
+ | |- | ||
+ | |TR pink | ||
+ | | E | ||
+ | | ppc | ||
+ | | AGCATACTGACATTACTACGCAATG | ||
+ | | Coding region | ||
+ | | Non-Template | ||
+ | |[[Media: DATA_mod_2.xlsx | Pink Team data ]] | ||
+ | |- | ||
+ | |TR purple | ||
+ | | E | ||
+ | | ldhA | ||
+ | | CTTAAATGTGATTCAACATCACTGG | ||
+ | | Promoter region | ||
+ | | Template | ||
+ | |[[Media:TRpurple_rawdata_ethanol.xlsx | Purple Team Data ]] | ||
+ | |} | ||
+ | |||
+ | ====W/F==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''Ethanol (E) or Acetate (A)''' | ||
+ | |'''Gene targeted by CRISPRi gRNA''' | ||
+ | |'''gRNA (DNA) sequence (without tag at 3' end)''' | ||
+ | |'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)''' | ||
+ | |'''Target template or nontemplate strand''' | ||
+ | |'''Colorimetric Assay Results''' | ||
+ | |- | ||
+ | |WF Cyan | ||
+ | | E | ||
+ | | frd | ||
+ | | GTGGGATAAAAACAATCTGG | ||
+ | | promoter | ||
+ | | Template | ||
+ | |[[Media:Athena Nguyen frd WF.xlsx | WF FRD DATA ATHENA]] | ||
+ | |- | ||
+ | |WF Cyan | ||
+ | | A | ||
+ | | ppc | ||
+ | | ACTGACATTACTACGCAATG | ||
+ | | beginning of gene | ||
+ | | Non-template | ||
+ | |[[Media:M2ColorimetricAssay Acetate PPC WF.xlsx | WF PPC Data]] | ||
|- | |- | ||
− | | WF | + | |WF Cyan |
− | | [[Media: |WF | + | | E |
+ | | pta | ||
+ | | TTTGTAACCCGCCAAATCGG | ||
+ | | promoter | ||
+ | | Template | ||
+ | |[[Media:M2ColorimetricAssay Template.xlsx | WF pta data ]] | ||
|- | |- | ||
|} | |} | ||
+ | [[File:TR_Yeloow_Western.xlsx]] |
Latest revision as of 19:04, 3 December 2019
Contents
Module 1: Measuring genomic instability
M1D5
gamma-H2AX analysis
Team | Upload, then link the completed excel spreadsheet from the wiki here! |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Cyan | WF Team Data |
M1D6
Comet Chip analysis
Team | |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Cyan | WF Team Data |
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR orange | E | ldhA | GTACTGTTTTGTGCTATAAA | Coding region | Non-template | Orange Team Data |
TR yellow | E | ldhA | AAATTCCAGCTCAAAGCCAAAGG | Coding region | Non-template | Yellow Team Data |
TR green | E | ack | TTAGCCACGTATCAATTATAGG | Promoter Region | Template | Green Team Data |
TR blue | A | adhE | ccagagcggcggcgcggaag | Coding region | Non-template | Blue Team data |
TR pink | E | ppc | AGCATACTGACATTACTACGCAATG | Coding region | Non-Template | Pink Team data |
TR purple | E | ldhA | CTTAAATGTGATTCAACATCACTGG | Promoter region | Template | Purple Team Data |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF Cyan | E | frd | GTGGGATAAAAACAATCTGG | promoter | Template | WF FRD DATA ATHENA |
WF Cyan | A | ppc | ACTGACATTACTACGCAATG | beginning of gene | Non-template | WF PPC Data |
WF Cyan | E | pta | TTTGTAACCCGCCAAATCGG | promoter | Template | WF pta data |