http://measurebiology.org/w/index.php?title=Special:RecentChanges&feed=atom&days=30
Course Wiki - Recent changes [en]
2024-03-29T15:45:24Z
Track the most recent changes to the wiki in this feed.
MediaWiki 1.22.3
http://measurebiology.org/w/index.php?title=20.109(S24):FYI&diff=52484&oldid=52116
20.109(S24):FYI
2024-03-25T12:37:08Z
<p><span dir="auto"><span class="autocomment">Where and when to find help</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 12:37, 25 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 25:</td>
<td colspan="2" class="diff-lineno">Line 25:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**[https://mit.zoom.us/j/97338007771 Zoom access]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**[https://mit.zoom.us/j/97338007771 Zoom access]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**To join Zoom session by phone: call 1 (646) 558 8656 and use Meeting ID 973 380 077 71</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**To join Zoom session by phone: call 1 (646) 558 8656 and use Meeting ID 973 380 077 71</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>*Jamie: '''Tuesdays and Thursdays 10-11a in 16-469 and at Zoom'''</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*Jamie: '''Tuesdays and Thursdays 10-11a in 16-469 and at Zoom <ins class="diffchange diffchange-inline">(by appt during spring break)</ins>'''</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**[https://mit.zoom.us/j/7169776877 Zoom access]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**[https://mit.zoom.us/j/7169776877 Zoom access]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**To join Zoom session by phone: call 1 (646) 558 8656 and use Meeting ID 716 977 6877</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**To join Zoom session by phone: call 1 (646) 558 8656 and use Meeting ID 716 977 6877</div></td></tr>
</table>
Zhanj
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52483&oldid=52481
20.109(S24):Spring 2024 schedule
2024-03-22T18:56:49Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 18:56, 22 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 101:</td>
<td colspan="2" class="diff-lineno">Line 101:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L3 AMB.pdf | Lecture slides]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L3 AMB.pdf | Lecture slides]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> [[Media:Sp24 TR JADiscussion bcm.pdf |TR prelab slides]] <br> [[Media:<del class="diffchange diffchange-inline">Sp24 </del>WF JADiscussion bcm.pdf | WF prelab]]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> [[Media:Sp24 TR JADiscussion bcm.pdf |TR prelab slides]] <br> [[Media:<ins class="diffchange diffchange-inline">UpdateSp24 </ins>WF JADiscussion bcm.pdf | WF prelab]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/wiki/File:UpdateSp24_WF_JADiscussion_bcm.pdf
File:UpdateSp24 WF JADiscussion bcm.pdf
2024-03-22T18:56:15Z
<p><a href="/w/index.php?title=User:Becky_Meyer&action=edit&redlink=1" class="new mw-userlink" title="User:Becky Meyer (page does not exist)">Becky Meyer</a> uploaded "<a href="/wiki/File:UpdateSp24_WF_JADiscussion_bcm.pdf" title="File:UpdateSp24 WF JADiscussion bcm.pdf">File:UpdateSp24 WF JADiscussion bcm.pdf</a>"</p>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52481&oldid=52478
20.109(S24):Spring 2024 schedule
2024-03-22T17:40:31Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 17:40, 22 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 101:</td>
<td colspan="2" class="diff-lineno">Line 101:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L3 AMB.pdf | Lecture slides]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L3 AMB.pdf | Lecture slides]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <ins class="diffchange diffchange-inline">[[Media:Sp24 TR JADiscussion bcm.pdf |TR prelab slides]] <br> [[Media:Sp24 WF JADiscussion bcm.pdf | WF prelab]]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/wiki/File:Sp24_WF_JADiscussion_bcm.pdf
File:Sp24 WF JADiscussion bcm.pdf
2024-03-22T17:40:06Z
<p><a href="/w/index.php?title=User:Becky_Meyer&action=edit&redlink=1" class="new mw-userlink" title="User:Becky Meyer (page does not exist)">Becky Meyer</a> uploaded "<a href="/wiki/File:Sp24_WF_JADiscussion_bcm.pdf" title="File:Sp24 WF JADiscussion bcm.pdf">File:Sp24 WF JADiscussion bcm.pdf</a>"</p>
Becky Meyer
http://measurebiology.org/wiki/File:Sp24_TR_JADiscussion_bcm.pdf
File:Sp24 TR JADiscussion bcm.pdf
2024-03-22T17:38:59Z
<p><a href="/w/index.php?title=User:Becky_Meyer&action=edit&redlink=1" class="new mw-userlink" title="User:Becky Meyer (page does not exist)">Becky Meyer</a> uploaded "<a href="/wiki/File:Sp24_TR_JADiscussion_bcm.pdf" title="File:Sp24 TR JADiscussion bcm.pdf">File:Sp24 TR JADiscussion bcm.pdf</a>"</p>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52478&oldid=52470
20.109(S24):Spring 2024 schedule
2024-03-21T15:11:53Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 15:11, 21 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 100:</td>
<td colspan="2" class="diff-lineno">Line 100:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D4</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D4</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br> <ins class="diffchange diffchange-inline">[[Media:Sp24 L3 AMB.pdf | Lecture slides]]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/wiki/File:Sp24_L3_AMB.pdf
File:Sp24 L3 AMB.pdf
2024-03-21T15:11:14Z
<p><a href="/w/index.php?title=User:Becky_Meyer&action=edit&redlink=1" class="new mw-userlink" title="User:Becky Meyer (page does not exist)">Becky Meyer</a> uploaded "<a href="/wiki/File:Sp24_L3_AMB.pdf" title="File:Sp24 L3 AMB.pdf">File:Sp24 L3 AMB.pdf</a>"</p>
Becky Meyer
http://measurebiology.org/wiki/File:QD_20.109_Sp_2024_lecture_3.pptx
File:QD 20.109 Sp 2024 lecture 3.pptx
2024-03-21T15:10:31Z
<p><a href="/w/index.php?title=User:Becky_Meyer&action=edit&redlink=1" class="new mw-userlink" title="User:Becky Meyer (page does not exist)">Becky Meyer</a> uploaded "<a href="/wiki/File:QD_20.109_Sp_2024_lecture_3.pptx" title="File:QD 20.109 Sp 2024 lecture 3.pptx">File:QD 20.109 Sp 2024 lecture 3.pptx</a>"</p>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):Communication&diff=52475&oldid=52473
20.109(S24):Communication
2024-03-21T13:56:41Z
<p><span dir="auto"><span class="autocomment">Workshop Slides and Resources</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 13:56, 21 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 33:</td>
<td colspan="2" class="diff-lineno">Line 33:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*** BE CommKit article: [https://mitcommlab.mit.edu/be/commkit/journal-article-abstract/ Journal Article - Abstract]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*** BE CommKit article: [https://mitcommlab.mit.edu/be/commkit/journal-article-abstract/ Journal Article - Abstract]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*'''Workshop #4: Oral Presentations'''</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*'''Workshop #4: Oral Presentations'''</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>** Slides</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>** <ins class="diffchange diffchange-inline">[[Media:20_109_Workshop4_AbstractsTitles_SP24.pdf| </ins>Slides<ins class="diffchange diffchange-inline">]]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Additional Resources:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Additional Resources:</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*** [[Media:Workshop4_AdditionalResources_SP24.pdf | Tips for slide presentation and design]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*** [[Media:Workshop4_AdditionalResources_SP24.pdf | Tips for slide presentation and design]]</div></td></tr>
</table>
Chiara J Ricci-Tam
http://measurebiology.org/wiki/File:20_109_Workshop4_AbstractsTitles_SP24.pdf
File:20 109 Workshop4 AbstractsTitles SP24.pdf
2024-03-21T13:25:24Z
<p><a href="/w/index.php?title=User:Chiara_J_Ricci-Tam&action=edit&redlink=1" class="new mw-userlink" title="User:Chiara J Ricci-Tam (page does not exist)">Chiara J Ricci-Tam</a> uploaded "<a href="/wiki/File:20_109_Workshop4_AbstractsTitles_SP24.pdf" title="File:20 109 Workshop4 AbstractsTitles SP24.pdf">File:20 109 Workshop4 AbstractsTitles SP24.pdf</a>"</p>
Chiara J Ricci-Tam
http://measurebiology.org/w/index.php?title=20.109(S24):Communication&diff=52473&oldid=52252
20.109(S24):Communication
2024-03-21T13:03:21Z
<p><span dir="auto"><span class="autocomment">Workshop Slides and Resources</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 13:03, 21 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(One intermediate revision by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 33:</td>
<td colspan="2" class="diff-lineno">Line 33:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*** BE CommKit article: [https://mitcommlab.mit.edu/be/commkit/journal-article-abstract/ Journal Article - Abstract]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*** BE CommKit article: [https://mitcommlab.mit.edu/be/commkit/journal-article-abstract/ Journal Article - Abstract]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*'''Workshop #4: Oral Presentations'''</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*'''Workshop #4: Oral Presentations'''</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>**  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>** <ins class="diffchange diffchange-inline">Slides</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">** Additional Resources:</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*** [[Media:Workshop4_AdditionalResources_SP24.pdf | Tips for slide presentation and design]]</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*** BE CommKit article: [https://mitcommlab.mit.edu/be/commkit/slideshow/ Slideshow]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*'''Workshop #5: Research Manuscripts'''</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*'''Workshop #5: Research Manuscripts'''</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>**  </div></td></tr>
</table>
Chiara J Ricci-Tam
http://measurebiology.org/wiki/File:Workshop4_AdditionalResources_SP24.pdf
File:Workshop4 AdditionalResources SP24.pdf
2024-03-21T12:33:28Z
<p><a href="/w/index.php?title=User:Chiara_J_Ricci-Tam&action=edit&redlink=1" class="new mw-userlink" title="User:Chiara J Ricci-Tam (page does not exist)">Chiara J Ricci-Tam</a> uploaded "<a href="/wiki/File:Workshop4_AdditionalResources_SP24.pdf" title="File:Workshop4 AdditionalResources SP24.pdf">File:Workshop4 AdditionalResources SP24.pdf</a>"</p>
Chiara J Ricci-Tam
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52470&oldid=52465
20.109(S24):Spring 2024 schedule
2024-03-20T16:37:27Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 16:37, 20 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(One intermediate revision by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 95:</td>
<td colspan="2" class="diff-lineno">Line 95:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR <ins class="diffchange diffchange-inline">prelab slides]]<br> [[Media:Sp24_M2D3_jz.pdf|WF </ins>prelab slides]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td></tr>
</table>
Zhanj
http://measurebiology.org/wiki/File:Sp24_M2D3_jz.pdf
File:Sp24 M2D3 jz.pdf
2024-03-20T16:36:27Z
<p><a href="/w/index.php?title=User:Zhanj&action=edit&redlink=1" class="new mw-userlink" title="User:Zhanj (page does not exist)">Zhanj</a> uploaded "<a href="/wiki/File:Sp24_M2D3_jz.pdf" title="File:Sp24 M2D3 jz.pdf">File:Sp24 M2D3 jz.pdf</a>"</p>
Zhanj
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52467&oldid=52455
20.109(S24):Journal article presentation
2024-03-19T18:27:33Z
<p><span dir="auto"><span class="autocomment">Detection of heavy metals</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 18:27, 19 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(One intermediate revision by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 135:</td>
<td colspan="2" class="diff-lineno">Line 135:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = blue><b>[LP/WF/Blue]</b></font color>Tzroya, A., ''et. al.'' "[[Media:Tzroya 2024 Iso-pathlength point characterization.pdf| Optical Method for Detection and Classification of Heavy Metal Contaminants in Water Using Iso-pathlength Point Characterization.]]" (2024) ACS Omega. https://doi.org/10.1021/acsomega.3c08792</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = blue><b>[LP/WF/Blue]</b></font color>Tzroya, A., ''et. al.'' "[[Media:Tzroya 2024 Iso-pathlength point characterization.pdf| Optical Method for Detection and Classification of Heavy Metal Contaminants in Water Using Iso-pathlength Point Characterization.]]" (2024) ACS Omega. https://doi.org/10.1021/acsomega.3c08792</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wei, H., ''et. al.'' "[[Media:Wei metabolic response E coli water sensor.pdf | Decoding the metabolic response of Escherichia coli for sensing trace heavy metals in water.]]" (2022) PNAS. https://doi.org/10.1073/pnas.2210061120</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wei, H., ''et. al.'' "[[Media:Wei metabolic response E coli water sensor.pdf | Decoding the metabolic response of Escherichia coli for sensing trace heavy metals in water.]]" (2022) PNAS. https://doi.org/10.1073/pnas.2210061120</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Yu, Y., ''et. al.'' "[[Media:Yu 2024 CRISPR system Hg detection.pdf| Bi‑functionality of glyoxal caged nucleic acid coupled with CRISPR/Cas12a system for Hg2+ determination.]]" (2022) Microchimica Acta. https://doi.org/10.1007/s00604-024-06196-5</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<ins class="diffchange diffchange-inline"><font color = teal><b>[MT/WF/Teal]</b></font color></ins>Yu, Y., ''et. al.'' "[[Media:Yu 2024 CRISPR system Hg detection.pdf| Bi‑functionality of glyoxal caged nucleic acid coupled with CRISPR/Cas12a system for Hg2+ determination.]]" (2022) Microchimica Acta. https://doi.org/10.1007/s00604-024-06196-5</div></td></tr>
</table>
Meryl T
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52465&oldid=52463
20.109(S24):Spring 2024 schedule
2024-03-19T17:25:06Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 17:25, 19 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(One intermediate revision by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 88:</td>
<td colspan="2" class="diff-lineno">Line 88:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D2</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D2</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 14/15</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 14/15</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <del class="diffchange diffchange-inline">AB</del>] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <ins class="diffchange diffchange-inline">AMB</ins>] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color =  #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color =  #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm</div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 94:</td>
<td colspan="2" class="diff-lineno">Line 94:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D3</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D3</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <del class="diffchange diffchange-inline">AB</del>] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <ins class="diffchange diffchange-inline">AMB</ins>] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 100:</td>
<td colspan="2" class="diff-lineno">Line 100:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D4</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D4</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 21/22  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <del class="diffchange diffchange-inline">AB</del>] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <ins class="diffchange diffchange-inline">AMB</ins>] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]]  </div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 124:</td>
<td colspan="2" class="diff-lineno">Line 124:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D5</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D5</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Apr 9/10</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Apr 9/10</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <del class="diffchange diffchange-inline">AB</del>] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <ins class="diffchange diffchange-inline">AMB</ins>] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D5|Homework due]]  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D5|Homework due]]  </div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 130:</td>
<td colspan="2" class="diff-lineno">Line 130:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D6</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D6</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Apr 11/12</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Apr 11/12</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <del class="diffchange diffchange-inline">AB</del>] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <ins class="diffchange diffchange-inline">AMB</ins>] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D5|Homework due]]   </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D5|Homework due]]   </div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 154:</td>
<td colspan="2" class="diff-lineno">Line 154:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M3D1</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M3D1</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Apr 25/26</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Apr 25/26</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <del class="diffchange diffchange-inline">AB</del>] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher <ins class="diffchange diffchange-inline">AMB</ins>] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br></div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52463&oldid=52460
20.109(S24):Spring 2024 schedule
2024-03-19T15:14:57Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 15:14, 19 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(One intermediate revision by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 95:</td>
<td colspan="2" class="diff-lineno">Line 95:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> <ins class="diffchange diffchange-inline">[[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td></tr>
</table>
Noreen Lyell
http://measurebiology.org/wiki/File:Sp24_M2D3_nll.pdf
File:Sp24 M2D3 nll.pdf
2024-03-19T15:13:46Z
<p><a href="/w/index.php?title=User:Noreen_Lyell&action=edit&redlink=1" class="new mw-userlink" title="User:Noreen Lyell (page does not exist)">Noreen Lyell</a> uploaded "<a href="/wiki/File:Sp24_M2D3_nll.pdf" title="File:Sp24 M2D3 nll.pdf">File:Sp24 M2D3 nll.pdf</a>"</p>
Noreen Lyell
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52460&oldid=52453
20.109(S24):Spring 2024 schedule
2024-03-19T15:09:46Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 15:09, 19 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 94:</td>
<td colspan="2" class="diff-lineno">Line 94:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D3</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| M2D3</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| T/W Mar 19/20</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AB] <br>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AB] <br> <ins class="diffchange diffchange-inline">[[Media:Sp24 L2 AMB.pdf | Lecture slides]]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br>  </div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/wiki/File:Sp24_L2_AMB.pdf
File:Sp24 L2 AMB.pdf
2024-03-19T15:08:29Z
<p><a href="/w/index.php?title=User:Becky_Meyer&action=edit&redlink=1" class="new mw-userlink" title="User:Becky Meyer (page does not exist)">Becky Meyer</a> uploaded "<a href="/wiki/File:Sp24_L2_AMB.pdf" title="File:Sp24 L2 AMB.pdf">File:Sp24 L2 AMB.pdf</a>"</p>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):M2D4&diff=52458&oldid=52309
20.109(S24):M2D4
2024-03-18T19:59:00Z
<p><span dir="auto"><span class="autocomment">Part 2: Participate in Communication Lab workshop</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 19:59, 18 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 56:</td>
<td colspan="2" class="diff-lineno">Line 56:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Our communication instructor, Dr. Chiara Ricci-Tam, will join us today for a discussion on oral presentations. We will also have an intensive workshop on preparing for your journal article presentation as part of this extended workshop.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Our communication instructor, Dr. Chiara Ricci-Tam, will join us today for a discussion on oral presentations. We will also have an intensive workshop on preparing for your journal article presentation as part of this extended workshop.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">You will get a chance to practice your slide and script from homework as part of this Comm Lab.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Reagents list==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Reagents list==</div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):M2D3&diff=52457&oldid=52454
20.109(S24):M2D3
2024-03-18T16:02:53Z
<p><span dir="auto"><span class="autocomment">Part 3: Prepare plasmid clones for sequencing analysis</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 16:02, 18 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(One intermediate revision by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 88:</td>
<td colspan="2" class="diff-lineno">Line 88:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>! Sequence</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>! Sequence</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| <del class="diffchange diffchange-inline">M13R_Fwd</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| <ins class="diffchange diffchange-inline">Seq1_Fwd</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| 5' - <del class="diffchange diffchange-inline">CAGGAAACAGCTATGAC </del> - 3'</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| 5' - <ins class="diffchange diffchange-inline">CCTCAACAACTAGCAAAGGC </ins> - 3'</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| <del class="diffchange diffchange-inline">M13F_Fwd</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| <ins class="diffchange diffchange-inline">M13F_Rev</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| 5' - GTAAAACGACGGCCAG  - 3'</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| 5' - GTAAAACGACGGCCAG  - 3'</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|-</div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52455&oldid=52452
20.109(S24):Journal article presentation
2024-03-15T16:58:14Z
<p><span dir="auto"><span class="autocomment">Detection of heavy metals</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 16:58, 15 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 133:</td>
<td colspan="2" class="diff-lineno">Line 133:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Liu, Y., ''et. al.'' "[[Media:Liu gas reporting whole-cell microbial biosensor system.pdf| A gas reporting whole-cell microbial biosensor system for rapid on-site detection of mercury contamination in soils.]]" (2020) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2020.112660</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Liu, Y., ''et. al.'' "[[Media:Liu gas reporting whole-cell microbial biosensor system.pdf| A gas reporting whole-cell microbial biosensor system for rapid on-site detection of mercury contamination in soils.]]" (2020) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2020.112660</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Pan, S., ''et. al.'' "[[Media:Pan EMS NanoSIMS PB Cd stress.pdf | Electron microscopic imaging and NanoSIMS investigation on physiological responses of Aspergillus niger under Pb(II) and Cd(II) stress.]]" (2023) Frontiers in Bioengineering and Biotechnology. DOI:10.3389/fbioe.2022.1096384</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Pan, S., ''et. al.'' "[[Media:Pan EMS NanoSIMS PB Cd stress.pdf | Electron microscopic imaging and NanoSIMS investigation on physiological responses of Aspergillus niger under Pb(II) and Cd(II) stress.]]" (2023) Frontiers in Bioengineering and Biotechnology. DOI:10.3389/fbioe.2022.1096384</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Tzroya, A., ''et. al.'' "[[Media:Tzroya 2024 Iso-pathlength point characterization.pdf| Optical Method for Detection and Classification of Heavy Metal Contaminants in Water Using Iso-pathlength Point Characterization.]]" (2024) ACS Omega. https://doi.org/10.1021/acsomega.3c08792</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<ins class="diffchange diffchange-inline"><font color = blue><b>[LP/WF/Blue]</b></font color></ins>Tzroya, A., ''et. al.'' "[[Media:Tzroya 2024 Iso-pathlength point characterization.pdf| Optical Method for Detection and Classification of Heavy Metal Contaminants in Water Using Iso-pathlength Point Characterization.]]" (2024) ACS Omega. https://doi.org/10.1021/acsomega.3c08792</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wei, H., ''et. al.'' "[[Media:Wei metabolic response E coli water sensor.pdf | Decoding the metabolic response of Escherichia coli for sensing trace heavy metals in water.]]" (2022) PNAS. https://doi.org/10.1073/pnas.2210061120</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wei, H., ''et. al.'' "[[Media:Wei metabolic response E coli water sensor.pdf | Decoding the metabolic response of Escherichia coli for sensing trace heavy metals in water.]]" (2022) PNAS. https://doi.org/10.1073/pnas.2210061120</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Yu, Y., ''et. al.'' "[[Media:Yu 2024 CRISPR system Hg detection.pdf| Bi‑functionality of glyoxal caged nucleic acid coupled with CRISPR/Cas12a system for Hg2+ determination.]]" (2022) Microchimica Acta. https://doi.org/10.1007/s00604-024-06196-5</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Yu, Y., ''et. al.'' "[[Media:Yu 2024 CRISPR system Hg detection.pdf| Bi‑functionality of glyoxal caged nucleic acid coupled with CRISPR/Cas12a system for Hg2+ determination.]]" (2022) Microchimica Acta. https://doi.org/10.1007/s00604-024-06196-5</div></td></tr>
</table>
Luc P
http://measurebiology.org/w/index.php?title=20.109(S24):M2D3&diff=52454&oldid=52385
20.109(S24):M2D3
2024-03-15T16:56:57Z
<p><span dir="auto"><span class="autocomment">Part 1: Mini-prep peptide clones</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 16:56, 15 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 21:</td>
<td colspan="2" class="diff-lineno">Line 21:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>For timing reasons, two colonies from the spread plates you prepared in the previous laboratory session were inoculated into LB/Amp and grown overnight at 37&deg;C on a rotator.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>For timing reasons, two colonies from the spread plates you prepared in the previous laboratory session were inoculated into LB/Amp and grown overnight at 37&deg;C on a rotator.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Retrieve your two cultures from the font laboratory bench. Label two eppendorf tubes to reflect your samples (Clone#1 <del class="diffchange diffchange-inline">and Clone</del>#2).  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#Retrieve your two cultures from the font laboratory bench. Label two eppendorf tubes to reflect your samples (Clone#1 #2 <ins class="diffchange diffchange-inline">#3</ins>).  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Vortex the bacterial cultures and pour ~1.5 mL of each into the appropriate eppendorf tube. [[Image:Removing cells.jpg|thumb|right|200px|'''Diagram showing how to aspirate the supernatant.'''  Be careful to remove as few cells as possible.]]  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Vortex the bacterial cultures and pour ~1.5 mL of each into the appropriate eppendorf tube. [[Image:Removing cells.jpg|thumb|right|200px|'''Diagram showing how to aspirate the supernatant.'''  Be careful to remove as few cells as possible.]]  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Balance the tubes in the microfuge, spin them at maximum speed for 2 min, and remove the supernatants with the vacuum aspirator.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Balance the tubes in the microfuge, spin them at maximum speed for 2 min, and remove the supernatants with the vacuum aspirator.</div></td></tr>
</table>
Becky Meyer
http://measurebiology.org/w/index.php?title=20.109(S24):Spring_2024_schedule&diff=52453&oldid=52425
20.109(S24):Spring 2024 schedule
2024-03-15T16:48:44Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 16:48, 15 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 89:</td>
<td colspan="2" class="diff-lineno">Line 89:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 14/15</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| R/F Mar 14/15</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [http://be.mit.edu/directory/angela-belcher AB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR <ins class="diffchange diffchange-inline">prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF </ins>prelab slides]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color =  #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color =  #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|--</div></td></tr>
</table>
Zhanj
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52452&oldid=52450
20.109(S24):Journal article presentation
2024-03-15T03:56:06Z
<p><span dir="auto"><span class="autocomment">Bioremediation approaches</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 03:56, 15 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(One intermediate revision by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 105:</td>
<td colspan="2" class="diff-lineno">Line 105:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = red><b>[KN/WF/Red]</b></font color>Ma, H., ''et. al.'' "[[Media:Ma 2020 TZ5 biochar.pdf| Bioremediation of cadmium polluted soil using a novel cadmium immobilizing plant growth promotion strain Bacillus sp. TZ5 loaded on biochar.]]". (2020) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2020.122065</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = red><b>[KN/WF/Red]</b></font color>Ma, H., ''et. al.'' "[[Media:Ma 2020 TZ5 biochar.pdf| Bioremediation of cadmium polluted soil using a novel cadmium immobilizing plant growth promotion strain Bacillus sp. TZ5 loaded on biochar.]]". (2020) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2020.122065</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Mao, Q., ''et. al.'' "[[Media:Mao cyanobacteria arsenic remediation.pdf| Indigenous cyanobacteria enhances remediation of arsenic-contaminated soils by regulating physicochemical properties, microbial community structure and function in soil microenvironment.]]". (2023) Science of the Total Environment. http://dx.doi.org/10.1016/j.scitotenv.2022.160543</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Mao, Q., ''et. al.'' "[[Media:Mao cyanobacteria arsenic remediation.pdf| Indigenous cyanobacteria enhances remediation of arsenic-contaminated soils by regulating physicochemical properties, microbial community structure and function in soil microenvironment.]]". (2023) Science of the Total Environment. http://dx.doi.org/10.1016/j.scitotenv.2022.160543</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Sengupta, D., ''et. al.'' "[[Media:Sengupta 2021 surfactant remediation.pdf| Prospective bioremediation of toxic heavy metals in water by surfactant exopolysaccharide of Ochrobactrum pseudintermedium using cost‑effective substrate.]]". (2021) International Microbiology. https://doi.org/10.1007/s10123-021-00182-0</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<ins class="diffchange diffchange-inline"><font color = blue><b>[KP/WF/Blue]</b></font color> </ins>Sengupta, D., ''et. al.'' "[[Media:Sengupta 2021 surfactant remediation.pdf| Prospective bioremediation of toxic heavy metals in water by surfactant exopolysaccharide of Ochrobactrum pseudintermedium using cost‑effective substrate.]]". (2021) International Microbiology. https://doi.org/10.1007/s10123-021-00182-0</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Tripathi, S., ''et. al.'' "[[Media:Tripathi 2021 IITRIND2 under cadmium stress.pdf| Elucidating the bioremediation mechanism of Scenedesmus sp. IITRIND2 under cadmium stress.]]". (2021) Chemosphere. https://doi.org/10.1016/j.chemosphere.2021.131196</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Tripathi, S., ''et. al.'' "[[Media:Tripathi 2021 IITRIND2 under cadmium stress.pdf| Elucidating the bioremediation mechanism of Scenedesmus sp. IITRIND2 under cadmium stress.]]". (2021) Chemosphere. https://doi.org/10.1016/j.chemosphere.2021.131196</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wu, K., ''et. al.'' "[[Media:Wu cadmium binding graphene oxide.pdf | Integrating FTIR 2D correlation analyses, regular and omics analyses studies on the interaction and algal toxicity mechanisms between graphene oxide and cadmium.]]". (2023) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2022.130298</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wu, K., ''et. al.'' "[[Media:Wu cadmium binding graphene oxide.pdf | Integrating FTIR 2D correlation analyses, regular and omics analyses studies on the interaction and algal toxicity mechanisms between graphene oxide and cadmium.]]". (2023) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2022.130298</div></td></tr>
</table>
Luc P
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52450&oldid=52449
20.109(S24):Journal article presentation
2024-03-15T03:49:54Z
<p><span dir="auto"><span class="autocomment">Uses of heavy metals</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 03:49, 15 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 117:</td>
<td colspan="2" class="diff-lineno">Line 117:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[KS/TR/Green]</b></font color>Chen, K., ''et. al.'' "[[Media:Chen 2024 Zn-Mg-CuMOF.pdf| Fabrication of a Nanoscale Magnesium/Copper Metal−Organic Framework on Zn-Based Guided Bone Generation Membranes for Enhancing Osteogenesis, Angiogenesis, and Bacteriostasis Properties.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c169703c03511</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[KS/TR/Green]</b></font color>Chen, K., ''et. al.'' "[[Media:Chen 2024 Zn-Mg-CuMOF.pdf| Fabrication of a Nanoscale Magnesium/Copper Metal−Organic Framework on Zn-Based Guided Bone Generation Membranes for Enhancing Osteogenesis, Angiogenesis, and Bacteriostasis Properties.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c169703c03511</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[DH/TR/Yellow]</b></font color> <font color = teal><b>[SH/WF/Teal]</b></font color>Im, S.H., ''et. al.'' "[[Media:Im 2024 CRISPR-polymer Cu electrochemical sensor.pdf| A Wireless, CRISPR-Polymer Dot Electrochemical Sensor for the Diagnosis of Bacterial Pneumonia and Multi-Drug Resistance.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c17151</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[DH/TR/Yellow]</b></font color> <font color = teal><b>[SH/WF/Teal]</b></font color>Im, S.H., ''et. al.'' "[[Media:Im 2024 CRISPR-polymer Cu electrochemical sensor.pdf| A Wireless, CRISPR-Polymer Dot Electrochemical Sensor for the Diagnosis of Bacterial Pneumonia and Multi-Drug Resistance.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c17151</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Lee, H., ''et. al.'' "[[Media:Lee 2024 Ag skin electronics.pdf |Phase‑separated stretchable conductive nanocomposite to reduce contact resistance of skin electronics.]]" (2024) Scientific Reports. https://doi.org/10.1038/s41598-024-51980-1  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<ins class="diffchange diffchange-inline"><font color = orange><b>[RL/WF/Orange]</b></font color> </ins>Lee, H., ''et. al.'' "[[Media:Lee 2024 Ag skin electronics.pdf |Phase‑separated stretchable conductive nanocomposite to reduce contact resistance of skin electronics.]]" (2024) Scientific Reports. https://doi.org/10.1038/s41598-024-51980-1  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = orange><b>[SL/WF/Orange]</b></font color> Sanmugam, A., ''et. al.'' "[[Media:Sanmugam 2024 Ag wound healing.pdf |Fabrication of chitosan/fibrin-armored multifunctional silver nanocomposites to improve antibacterial and wound healing activities.]]" (2024) International Journal of Biological Macromolecules. https://doi.org/10.1016/j.ijbiomac.2023.128598  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = orange><b>[SL/WF/Orange]</b></font color> Sanmugam, A., ''et. al.'' "[[Media:Sanmugam 2024 Ag wound healing.pdf |Fabrication of chitosan/fibrin-armored multifunctional silver nanocomposites to improve antibacterial and wound healing activities.]]" (2024) International Journal of Biological Macromolecules. https://doi.org/10.1016/j.ijbiomac.2023.128598  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[TB/TR/Pink]</b></font color> <font color = gold><b>[AL/WF/Yellow]</b></font color>Schwartz-Duval, A., ''et. al.'' "[[Media:Schwartz-Duval 2024 Au nanoclusters pancreatic cancer.pdf |Intratumoral Biosynthesis of Gold Nanoclusters by Pancreatic Cancer to Overcome Delivery Barriers to Radiosensitization.]]" (2024) ACS Nano. https://doi.org/10.1021/acsnano.3c04260</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[TB/TR/Pink]</b></font color> <font color = gold><b>[AL/WF/Yellow]</b></font color>Schwartz-Duval, A., ''et. al.'' "[[Media:Schwartz-Duval 2024 Au nanoclusters pancreatic cancer.pdf |Intratumoral Biosynthesis of Gold Nanoclusters by Pancreatic Cancer to Overcome Delivery Barriers to Radiosensitization.]]" (2024) ACS Nano. https://doi.org/10.1021/acsnano.3c04260</div></td></tr>
</table>
Rui L
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52449&oldid=52443
20.109(S24):Journal article presentation
2024-03-15T03:32:56Z
<p><span dir="auto"><span class="autocomment">Bioremediation approaches</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 03:32, 15 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(5 intermediate revisions by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 99:</td>
<td colspan="2" class="diff-lineno">Line 99:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># <font color = pink><b>[EW/TR/Pink]</b></font color> <font color = purple><b>[LM/WF/Purple]</b></font color> Howard, J., ''et. al.'' "[[Media:Howard oral cadmium chelating polymer.pdf | Combating lead and cadmium exposure with an orally administered chitosan‑based chelating polymer.]]" (2023) Scientific reports. https://doi.org/10.1038/s41598-023-28968-4</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># <font color = pink><b>[EW/TR/Pink]</b></font color> <font color = purple><b>[LM/WF/Purple]</b></font color> Howard, J., ''et. al.'' "[[Media:Howard oral cadmium chelating polymer.pdf | Combating lead and cadmium exposure with an orally administered chitosan‑based chelating polymer.]]" (2023) Scientific reports. https://doi.org/10.1038/s41598-023-28968-4</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># <font color = orange><b>[CK/TR/Orange]</b></font color> Ibuot, A., ''et. al.'' "[[Media:Ibuot 2020 Zn Cd AtHMA4 protein.pdf| Increased metal tolerance and bioaccumulation of zinc and cadmium in Chlamydomonas reinhardtii expressing a AtHMA4 C‐terminal domain protein.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27476</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># <font color = orange><b>[CK/TR/Orange]</b></font color> Ibuot, A., ''et. al.'' "[[Media:Ibuot 2020 Zn Cd AtHMA4 protein.pdf| Increased metal tolerance and bioaccumulation of zinc and cadmium in Chlamydomonas reinhardtii expressing a AtHMA4 C‐terminal domain protein.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27476</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[AG/TR/Pink]</b></font color> Jia, X., ''et. al.'' "[[Media:Jia 2020 Pb binding proteins E coli.pdf| Display of lead‐binding proteins on Escherichia coli surface for lead bioremediation.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27525</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[AG/TR/Pink<ins class="diffchange diffchange-inline">]</b></font color> <font color = purple><b>[OR/WF/Purple</ins>]</b></font color> Jia, X., ''et. al.'' "[[Media:Jia 2020 Pb binding proteins E coli.pdf| Display of lead‐binding proteins on Escherichia coli surface for lead bioremediation.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27525</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = blue><b>[SL/TR/Blue]</b></font color> Li, J., ''et. al.'' "[[Media:Li Pb bio-beads with bone char.pdf| Efficient lead immobilization by bio-beads containing Pseudomonas rhodesiae and bone char.]]". (2023) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2023.130772</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = blue><b>[SL/TR/Blue]</b></font color> Li, J., ''et. al.'' "[[Media:Li Pb bio-beads with bone char.pdf| Efficient lead immobilization by bio-beads containing Pseudomonas rhodesiae and bone char.]]". (2023) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2023.130772</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lone, S., ''et. al.'' "[[Media:Lone Gelatin-chitosan Hg removal.pdf | Gelatin–chitosan hydrogel particles for efficient removal of HgIJII) from wastewater.]]". (2019) Environ. Sci.: Water Res. Technol. DOI: 10.1039/c8ew00678d</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lone, S., ''et. al.'' "[[Media:Lone Gelatin-chitosan Hg removal.pdf | Gelatin–chitosan hydrogel particles for efficient removal of HgIJII) from wastewater.]]". (2019) Environ. Sci.: Water Res. Technol. DOI: 10.1039/c8ew00678d</div></td></tr>
</table>
Olivia R
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52443&oldid=52442
20.109(S24):Journal article presentation
2024-03-15T02:35:47Z
<p><span dir="auto"><span class="autocomment">Bioremediation approaches</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 02:35, 15 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 103:</td>
<td colspan="2" class="diff-lineno">Line 103:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lone, S., ''et. al.'' "[[Media:Lone Gelatin-chitosan Hg removal.pdf | Gelatin–chitosan hydrogel particles for efficient removal of HgIJII) from wastewater.]]". (2019) Environ. Sci.: Water Res. Technol. DOI: 10.1039/c8ew00678d</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lone, S., ''et. al.'' "[[Media:Lone Gelatin-chitosan Hg removal.pdf | Gelatin–chitosan hydrogel particles for efficient removal of HgIJII) from wastewater.]]". (2019) Environ. Sci.: Water Res. Technol. DOI: 10.1039/c8ew00678d</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[SM/TR/Yellow]</b></font color>Lu, C., ''et. al.'' "[[Media:Lu 2023 MTT5 E Coli bioremediation.pdf| Bioremediation potential of cadmium by recombinant Escherichia coli surface expressing metallothionein MTT5 from Tetrahymena thermophila.]]". (2023) Chemosphere. https://doi.org/10.1016/j.chemosphere.2022.136850</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[SM/TR/Yellow]</b></font color>Lu, C., ''et. al.'' "[[Media:Lu 2023 MTT5 E Coli bioremediation.pdf| Bioremediation potential of cadmium by recombinant Escherichia coli surface expressing metallothionein MTT5 from Tetrahymena thermophila.]]". (2023) Chemosphere. https://doi.org/10.1016/j.chemosphere.2022.136850</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Ma, H., ''et. al.'' "[[Media:Ma 2020 TZ5 biochar.pdf| Bioremediation of cadmium polluted soil using a novel cadmium immobilizing plant growth promotion strain Bacillus sp. TZ5 loaded on biochar.]]". (2020) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2020.122065</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<ins class="diffchange diffchange-inline"><font color = red><b>[KN/WF/Red]</b></font color></ins>Ma, H., ''et. al.'' "[[Media:Ma 2020 TZ5 biochar.pdf| Bioremediation of cadmium polluted soil using a novel cadmium immobilizing plant growth promotion strain Bacillus sp. TZ5 loaded on biochar.]]". (2020) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2020.122065</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Mao, Q., ''et. al.'' "[[Media:Mao cyanobacteria arsenic remediation.pdf| Indigenous cyanobacteria enhances remediation of arsenic-contaminated soils by regulating physicochemical properties, microbial community structure and function in soil microenvironment.]]". (2023) Science of the Total Environment. http://dx.doi.org/10.1016/j.scitotenv.2022.160543</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Mao, Q., ''et. al.'' "[[Media:Mao cyanobacteria arsenic remediation.pdf| Indigenous cyanobacteria enhances remediation of arsenic-contaminated soils by regulating physicochemical properties, microbial community structure and function in soil microenvironment.]]". (2023) Science of the Total Environment. http://dx.doi.org/10.1016/j.scitotenv.2022.160543</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Sengupta, D., ''et. al.'' "[[Media:Sengupta 2021 surfactant remediation.pdf| Prospective bioremediation of toxic heavy metals in water by surfactant exopolysaccharide of Ochrobactrum pseudintermedium using cost‑effective substrate.]]". (2021) International Microbiology. https://doi.org/10.1007/s10123-021-00182-0</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Sengupta, D., ''et. al.'' "[[Media:Sengupta 2021 surfactant remediation.pdf| Prospective bioremediation of toxic heavy metals in water by surfactant exopolysaccharide of Ochrobactrum pseudintermedium using cost‑effective substrate.]]". (2021) International Microbiology. https://doi.org/10.1007/s10123-021-00182-0</div></td></tr>
</table>
Kristine N
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52442&oldid=52441
20.109(S24):Journal article presentation
2024-03-15T02:31:05Z
<p><span dir="auto"><span class="autocomment">Bioremediation approaches</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 02:31, 15 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 97:</td>
<td colspan="2" class="diff-lineno">Line 97:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Bioremediation approaches===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Bioremediation approaches===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Acosta-Luque, M., ''et. al.'' "[[Media:Acosta-Luque Pb remediation.pdf | Remediation of Pb‑contaminated soil using biochar‑based slow‑release P fertilizer and biomonitoring employing bioindicators.]]" (2023) Scientific reports. https://doi.org/10.1038/s41598-022-27043-8</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Acosta-Luque, M., ''et. al.'' "[[Media:Acosta-Luque Pb remediation.pdf | Remediation of Pb‑contaminated soil using biochar‑based slow‑release P fertilizer and biomonitoring employing bioindicators.]]" (2023) Scientific reports. https://doi.org/10.1038/s41598-022-27043-8</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div># <font color = pink><b>[EW/TR/Pink]</b></font color> Howard, J., ''et. al.'' "[[Media:Howard oral cadmium chelating polymer.pdf | Combating lead and cadmium exposure with an orally administered chitosan‑based chelating polymer.]]" (2023) Scientific reports. https://doi.org/10.1038/s41598-023-28968-4</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div># <font color = pink><b>[EW/TR/Pink<ins class="diffchange diffchange-inline">]</b></font color> <font color = purple><b>[LM/WF/Purple</ins>]</b></font color> Howard, J., ''et. al.'' "[[Media:Howard oral cadmium chelating polymer.pdf | Combating lead and cadmium exposure with an orally administered chitosan‑based chelating polymer.]]" (2023) Scientific reports. https://doi.org/10.1038/s41598-023-28968-4</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># <font color = orange><b>[CK/TR/Orange]</b></font color> Ibuot, A., ''et. al.'' "[[Media:Ibuot 2020 Zn Cd AtHMA4 protein.pdf| Increased metal tolerance and bioaccumulation of zinc and cadmium in Chlamydomonas reinhardtii expressing a AtHMA4 C‐terminal domain protein.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27476</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># <font color = orange><b>[CK/TR/Orange]</b></font color> Ibuot, A., ''et. al.'' "[[Media:Ibuot 2020 Zn Cd AtHMA4 protein.pdf| Increased metal tolerance and bioaccumulation of zinc and cadmium in Chlamydomonas reinhardtii expressing a AtHMA4 C‐terminal domain protein.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27476</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[AG/TR/Pink]</b></font color> Jia, X., ''et. al.'' "[[Media:Jia 2020 Pb binding proteins E coli.pdf| Display of lead‐binding proteins on Escherichia coli surface for lead bioremediation.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27525</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[AG/TR/Pink]</b></font color> Jia, X., ''et. al.'' "[[Media:Jia 2020 Pb binding proteins E coli.pdf| Display of lead‐binding proteins on Escherichia coli surface for lead bioremediation.]]". (2020) Biotechnology and Bioengineering. DOI: 10.1002/bit.27525</div></td></tr>
</table>
Leena M
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52441&oldid=52438
20.109(S24):Journal article presentation
2024-03-15T01:58:32Z
<p><span dir="auto"><span class="autocomment">Uses of heavy metals</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 01:58, 15 March 2024</td>
</tr><tr><td colspan='4' style='text-align: center;' class='diff-multi'>(2 intermediate revisions by one user not shown)</td></tr><tr><td colspan="2" class="diff-lineno">Line 116:</td>
<td colspan="2" class="diff-lineno">Line 116:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[LP/WF/Pink]</b></font color>Chang, Z., ''et. al.'' "[[Media:Chang 2023 Pt-Se nanoprobes.pdf| Pt−Se-Bonded Nanoprobe for High-Fidelity Detection of Non-small Cell Lung Cancer and Enhancement of NIR II Photothermal Therapy.]]" (2023) Analytical Chemistry. https://doi.org/10.1021/acs.analchem.3c03511</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[LP/WF/Pink]</b></font color>Chang, Z., ''et. al.'' "[[Media:Chang 2023 Pt-Se nanoprobes.pdf| Pt−Se-Bonded Nanoprobe for High-Fidelity Detection of Non-small Cell Lung Cancer and Enhancement of NIR II Photothermal Therapy.]]" (2023) Analytical Chemistry. https://doi.org/10.1021/acs.analchem.3c03511</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[KS/TR/Green]</b></font color>Chen, K., ''et. al.'' "[[Media:Chen 2024 Zn-Mg-CuMOF.pdf| Fabrication of a Nanoscale Magnesium/Copper Metal−Organic Framework on Zn-Based Guided Bone Generation Membranes for Enhancing Osteogenesis, Angiogenesis, and Bacteriostasis Properties.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c169703c03511</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[KS/TR/Green]</b></font color>Chen, K., ''et. al.'' "[[Media:Chen 2024 Zn-Mg-CuMOF.pdf| Fabrication of a Nanoscale Magnesium/Copper Metal−Organic Framework on Zn-Based Guided Bone Generation Membranes for Enhancing Osteogenesis, Angiogenesis, and Bacteriostasis Properties.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c169703c03511</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[DH/TR/Yellow]</b></font color>Im, S.H., ''et. al.'' "[[Media:Im 2024 CRISPR-polymer Cu electrochemical sensor.pdf| A Wireless, CRISPR-Polymer Dot Electrochemical Sensor for the Diagnosis of Bacterial Pneumonia and Multi-Drug Resistance.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c17151</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[DH/TR/Yellow<ins class="diffchange diffchange-inline">]</b></font color> <font color = teal><b>[SH/WF/Teal</ins>]</b></font color>Im, S.H., ''et. al.'' "[[Media:Im 2024 CRISPR-polymer Cu electrochemical sensor.pdf| A Wireless, CRISPR-Polymer Dot Electrochemical Sensor for the Diagnosis of Bacterial Pneumonia and Multi-Drug Resistance.]]" (2024) Applied Materials & Interfaces. https://doi.org/10.1021/acsami.3c17151</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lee, H., ''et. al.'' "[[Media:Lee 2024 Ag skin electronics.pdf |Phase‑separated stretchable conductive nanocomposite to reduce contact resistance of skin electronics.]]" (2024) Scientific Reports. https://doi.org/10.1038/s41598-024-51980-1  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lee, H., ''et. al.'' "[[Media:Lee 2024 Ag skin electronics.pdf |Phase‑separated stretchable conductive nanocomposite to reduce contact resistance of skin electronics.]]" (2024) Scientific Reports. https://doi.org/10.1038/s41598-024-51980-1  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = orange><b>[SL/WF/Orange]</b></font color> Sanmugam, A., ''et. al.'' "[[Media:Sanmugam 2024 Ag wound healing.pdf |Fabrication of chitosan/fibrin-armored multifunctional silver nanocomposites to improve antibacterial and wound healing activities.]]" (2024) International Journal of Biological Macromolecules. https://doi.org/10.1016/j.ijbiomac.2023.128598  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = orange><b>[SL/WF/Orange]</b></font color> Sanmugam, A., ''et. al.'' "[[Media:Sanmugam 2024 Ag wound healing.pdf |Fabrication of chitosan/fibrin-armored multifunctional silver nanocomposites to improve antibacterial and wound healing activities.]]" (2024) International Journal of Biological Macromolecules. https://doi.org/10.1016/j.ijbiomac.2023.128598  </div></td></tr>
</table>
Sabrina H
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52438&oldid=52437
20.109(S24):Journal article presentation
2024-03-15T01:31:16Z
<p><span dir="auto"><span class="autocomment">Detection of heavy metals</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 01:31, 15 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 130:</td>
<td colspan="2" class="diff-lineno">Line 130:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Hasan, A., ''et. al.'' "[[Media:Hasan Nanozyme-based sensing platforms.pdf| Nanozyme-based sensing platforms for detection of toxic mercury ions: An alternative approach to conventional methods.]]" (2020) Talenta. https://doi.org/10.1016/j.talanta.2020.120939</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Hasan, A., ''et. al.'' "[[Media:Hasan Nanozyme-based sensing platforms.pdf| Nanozyme-based sensing platforms for detection of toxic mercury ions: An alternative approach to conventional methods.]]" (2020) Talenta. https://doi.org/10.1016/j.talanta.2020.120939</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Heidari, B., ''et. al.'' "[[Media:Heidari 2024 nanoparticle colorimetric sensor.pdf| Highly selective and sensitive recognition of multi‑ions in aqueous solution based on polymer‑grafted nanoparticle as visual colorimetric sensor.]]" (2024) Scientific reports. https://doi.org/10.1038/s41598-023-50627-x</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Heidari, B., ''et. al.'' "[[Media:Heidari 2024 nanoparticle colorimetric sensor.pdf| Highly selective and sensitive recognition of multi‑ions in aqueous solution based on polymer‑grafted nanoparticle as visual colorimetric sensor.]]" (2024) Scientific reports. https://doi.org/10.1038/s41598-023-50627-x</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Jung, J., ''et. al.'' "[[Media:Jung Cell-free biosensors for rapid detection of water contaminants.pdf| Cell-free biosensors for rapid detection of water contaminants.]]" (2020) Nature biotechnology. https://doi.org/10.1038/s41587-020-0571-7</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<ins class="diffchange diffchange-inline"><font color = green><b>[EJ/WF/Green]</b></font color></ins>Jung, J., ''et. al.'' "[[Media:Jung Cell-free biosensors for rapid detection of water contaminants.pdf| Cell-free biosensors for rapid detection of water contaminants.]]" (2020) Nature biotechnology. https://doi.org/10.1038/s41587-020-0571-7</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Liu, Y., ''et. al.'' "[[Media:Liu gas reporting whole-cell microbial biosensor system.pdf| A gas reporting whole-cell microbial biosensor system for rapid on-site detection of mercury contamination in soils.]]" (2020) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2020.112660</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Liu, Y., ''et. al.'' "[[Media:Liu gas reporting whole-cell microbial biosensor system.pdf| A gas reporting whole-cell microbial biosensor system for rapid on-site detection of mercury contamination in soils.]]" (2020) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2020.112660</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Pan, S., ''et. al.'' "[[Media:Pan EMS NanoSIMS PB Cd stress.pdf | Electron microscopic imaging and NanoSIMS investigation on physiological responses of Aspergillus niger under Pb(II) and Cd(II) stress.]]" (2023) Frontiers in Bioengineering and Biotechnology. DOI:10.3389/fbioe.2022.1096384</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Pan, S., ''et. al.'' "[[Media:Pan EMS NanoSIMS PB Cd stress.pdf | Electron microscopic imaging and NanoSIMS investigation on physiological responses of Aspergillus niger under Pb(II) and Cd(II) stress.]]" (2023) Frontiers in Bioengineering and Biotechnology. DOI:10.3389/fbioe.2022.1096384</div></td></tr>
</table>
Erin J
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52437&oldid=52436
20.109(S24):Journal article presentation
2024-03-14T21:18:40Z
<p><span dir="auto"><span class="autocomment">Uses of heavy metals</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 21:18, 14 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 119:</td>
<td colspan="2" class="diff-lineno">Line 119:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lee, H., ''et. al.'' "[[Media:Lee 2024 Ag skin electronics.pdf |Phase‑separated stretchable conductive nanocomposite to reduce contact resistance of skin electronics.]]" (2024) Scientific Reports. https://doi.org/10.1038/s41598-024-51980-1  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Lee, H., ''et. al.'' "[[Media:Lee 2024 Ag skin electronics.pdf |Phase‑separated stretchable conductive nanocomposite to reduce contact resistance of skin electronics.]]" (2024) Scientific Reports. https://doi.org/10.1038/s41598-024-51980-1  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = orange><b>[SL/WF/Orange]</b></font color> Sanmugam, A., ''et. al.'' "[[Media:Sanmugam 2024 Ag wound healing.pdf |Fabrication of chitosan/fibrin-armored multifunctional silver nanocomposites to improve antibacterial and wound healing activities.]]" (2024) International Journal of Biological Macromolecules. https://doi.org/10.1016/j.ijbiomac.2023.128598  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = orange><b>[SL/WF/Orange]</b></font color> Sanmugam, A., ''et. al.'' "[[Media:Sanmugam 2024 Ag wound healing.pdf |Fabrication of chitosan/fibrin-armored multifunctional silver nanocomposites to improve antibacterial and wound healing activities.]]" (2024) International Journal of Biological Macromolecules. https://doi.org/10.1016/j.ijbiomac.2023.128598  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[TB/TR/Pink]</b></font color>Schwartz-Duval, A., ''et. al.'' "[[Media:Schwartz-Duval 2024 Au nanoclusters pancreatic cancer.pdf |Intratumoral Biosynthesis of Gold Nanoclusters by Pancreatic Cancer to Overcome Delivery Barriers to Radiosensitization.]]" (2024) ACS Nano. https://doi.org/10.1021/acsnano.3c04260</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[TB/TR/Pink<ins class="diffchange diffchange-inline">]</b></font color> <font color = gold><b>[AL/WF/Yellow</ins>]</b></font color>Schwartz-Duval, A., ''et. al.'' "[[Media:Schwartz-Duval 2024 Au nanoclusters pancreatic cancer.pdf |Intratumoral Biosynthesis of Gold Nanoclusters by Pancreatic Cancer to Overcome Delivery Barriers to Radiosensitization.]]" (2024) ACS Nano. https://doi.org/10.1021/acsnano.3c04260</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Sheng, H., ''et. al.'' "[[Media:Sheng 2023 biodegradable zn supercapacitors.pdf |A soft implantable energy supply system that integrates wireless charging and biodegradable Zn-ion hybrid supercapacitors.]]" (2023) Science Advances. DOI: 10.1126/sciadv.adh80  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Sheng, H., ''et. al.'' "[[Media:Sheng 2023 biodegradable zn supercapacitors.pdf |A soft implantable energy supply system that integrates wireless charging and biodegradable Zn-ion hybrid supercapacitors.]]" (2023) Science Advances. DOI: 10.1126/sciadv.adh80  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[HW/WF/Green]</b></font color>Wang, J., ''et. al.'' "[[Media:Wang 2024 CRISPR Ag-Au nanostar.pdf |CRISPR/Cas9-mediated SERS/colorimetric dual-mode lateral flow platform combined with smartphone for rapid and sensitive detection of Staphylococcus aureus.]]" (2024) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2024.116046</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[HW/WF/Green]</b></font color>Wang, J., ''et. al.'' "[[Media:Wang 2024 CRISPR Ag-Au nanostar.pdf |CRISPR/Cas9-mediated SERS/colorimetric dual-mode lateral flow platform combined with smartphone for rapid and sensitive detection of Staphylococcus aureus.]]" (2024) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2024.116046</div></td></tr>
</table>
Anna L
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52436&oldid=52435
20.109(S24):Journal article presentation
2024-03-14T20:03:56Z
<p><span dir="auto"><span class="autocomment">Uses of heavy metals</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 20:03, 14 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 121:</td>
<td colspan="2" class="diff-lineno">Line 121:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[TB/TR/Pink]</b></font color>Schwartz-Duval, A., ''et. al.'' "[[Media:Schwartz-Duval 2024 Au nanoclusters pancreatic cancer.pdf |Intratumoral Biosynthesis of Gold Nanoclusters by Pancreatic Cancer to Overcome Delivery Barriers to Radiosensitization.]]" (2024) ACS Nano. https://doi.org/10.1021/acsnano.3c04260</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[TB/TR/Pink]</b></font color>Schwartz-Duval, A., ''et. al.'' "[[Media:Schwartz-Duval 2024 Au nanoclusters pancreatic cancer.pdf |Intratumoral Biosynthesis of Gold Nanoclusters by Pancreatic Cancer to Overcome Delivery Barriers to Radiosensitization.]]" (2024) ACS Nano. https://doi.org/10.1021/acsnano.3c04260</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Sheng, H., ''et. al.'' "[[Media:Sheng 2023 biodegradable zn supercapacitors.pdf |A soft implantable energy supply system that integrates wireless charging and biodegradable Zn-ion hybrid supercapacitors.]]" (2023) Science Advances. DOI: 10.1126/sciadv.adh80  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Sheng, H., ''et. al.'' "[[Media:Sheng 2023 biodegradable zn supercapacitors.pdf |A soft implantable energy supply system that integrates wireless charging and biodegradable Zn-ion hybrid supercapacitors.]]" (2023) Science Advances. DOI: 10.1126/sciadv.adh80  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#Wang, J., ''et. al.'' "[[Media:Wang 2024 CRISPR Ag-Au nanostar.pdf |CRISPR/Cas9-mediated SERS/colorimetric dual-mode lateral flow platform combined with smartphone for rapid and sensitive detection of Staphylococcus aureus.]]" (2024) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2024.116046</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<ins class="diffchange diffchange-inline"><font color = green><b>[HW/WF/Green]</b></font color></ins>Wang, J., ''et. al.'' "[[Media:Wang 2024 CRISPR Ag-Au nanostar.pdf |CRISPR/Cas9-mediated SERS/colorimetric dual-mode lateral flow platform combined with smartphone for rapid and sensitive detection of Staphylococcus aureus.]]" (2024) Biosensors and Bioelectronics. https://doi.org/10.1016/j.bios.2024.116046</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[NZ/WF/Yellow]</b></font color>Zare, A., ''et. al.'' "[[Media:Zare 2023 CuMOF nanobydrid probe.pdf |Label‑free electrochemical cancer cell detection leveraging hemoglobin‑encapsulated silver nanoclusters and Cu‑MOF nanohybrids on a graphene‑assisted dual‑modal probe.]]" (2023) Scientific Reports. https://doi.org/10.1038/s41598-023-49418-1</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = gold><b>[NZ/WF/Yellow]</b></font color>Zare, A., ''et. al.'' "[[Media:Zare 2023 CuMOF nanobydrid probe.pdf |Label‑free electrochemical cancer cell detection leveraging hemoglobin‑encapsulated silver nanoclusters and Cu‑MOF nanohybrids on a graphene‑assisted dual‑modal probe.]]" (2023) Scientific Reports. https://doi.org/10.1038/s41598-023-49418-1</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Hannah W
http://measurebiology.org/w/index.php?title=20.109(S24):Journal_article_presentation&diff=52435&oldid=52434
20.109(S24):Journal article presentation
2024-03-14T19:28:05Z
<p><span dir="auto"><span class="autocomment">Bioremediation approaches</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 19:28, 14 March 2024</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 108:</td>
<td colspan="2" class="diff-lineno">Line 108:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Tripathi, S., ''et. al.'' "[[Media:Tripathi 2021 IITRIND2 under cadmium stress.pdf| Elucidating the bioremediation mechanism of Scenedesmus sp. IITRIND2 under cadmium stress.]]". (2021) Chemosphere. https://doi.org/10.1016/j.chemosphere.2021.131196</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Tripathi, S., ''et. al.'' "[[Media:Tripathi 2021 IITRIND2 under cadmium stress.pdf| Elucidating the bioremediation mechanism of Scenedesmus sp. IITRIND2 under cadmium stress.]]". (2021) Chemosphere. https://doi.org/10.1016/j.chemosphere.2021.131196</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wu, K., ''et. al.'' "[[Media:Wu cadmium binding graphene oxide.pdf | Integrating FTIR 2D correlation analyses, regular and omics analyses studies on the interaction and algal toxicity mechanisms between graphene oxide and cadmium.]]". (2023) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2022.130298</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Wu, K., ''et. al.'' "[[Media:Wu cadmium binding graphene oxide.pdf | Integrating FTIR 2D correlation analyses, regular and omics analyses studies on the interaction and algal toxicity mechanisms between graphene oxide and cadmium.]]". (2023) Journal of Hazardous Materials. https://doi.org/10.1016/j.jhazmat.2022.130298</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[NS/TR/Green][VA/WF/Red]</b></font color> Wu, C., ''et. al.'' "[[Media:Wu fungus mercury remediation.pdf | Bioremediation of mercury-polluted soil and water by the plant symbiotic fungus Metarhizium robertsii.]]". (2022) PNAS. https://doi.org/10.1073/pnas.2214513119</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>#<font color = green><b>[NS/TR/Green]<ins class="diffchange diffchange-inline"></b></font color> <font color = red><b></ins>[VA/WF/Red]</b></font color> Wu, C., ''et. al.'' "[[Media:Wu fungus mercury remediation.pdf | Bioremediation of mercury-polluted soil and water by the plant symbiotic fungus Metarhizium robertsii.]]". (2022) PNAS. https://doi.org/10.1073/pnas.2214513119</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[LF/WF/Pink]</b></font color> Xue, Y., ''et. al.'' "[[Media:Xue 2022 Mercury bioremediation.pdf| Mercury bioremediation in aquatic environment by genetically modified bacteria with self-controlled biosecurity circuit.]]". (2022) Journal of Cleaner Production. https://doi.org/10.1016/j.jclepro.2022.130524</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#<font color = pink><b>[LF/WF/Pink]</b></font color> Xue, Y., ''et. al.'' "[[Media:Xue 2022 Mercury bioremediation.pdf| Mercury bioremediation in aquatic environment by genetically modified bacteria with self-controlled biosecurity circuit.]]". (2022) Journal of Cleaner Production. https://doi.org/10.1016/j.jclepro.2022.130524</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Yuan, B., ''et. al.'' "[[Media:Yuan 2022 mixotrophic acidophiles.pdf| Application of mixotrophic acidophiles for the bioremediation of cadmium-contaminated soils elevates cadmium removal, soil nutrient availability, and rice growth.]]". (2022). Ecotoxicology and Environmental Safety. https://doi.org/10.1016/j.ecoenv.2022.113499</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>#Yuan, B., ''et. al.'' "[[Media:Yuan 2022 mixotrophic acidophiles.pdf| Application of mixotrophic acidophiles for the bioremediation of cadmium-contaminated soils elevates cadmium removal, soil nutrient availability, and rice growth.]]". (2022). Ecotoxicology and Environmental Safety. https://doi.org/10.1016/j.ecoenv.2022.113499</div></td></tr>
</table>
Verose A