Difference between revisions of "20.109(S22):Class data"

From Course Wiki
Jump to: navigation, search
m
(T/R)
Line 210: Line 210:
 
|-
 
|-
 
| TR Purple
 
| TR Purple
|  
+
| Ethanol
|  
+
| ''pta''
|  
+
| GTAGGGATCAGCATAATAATAC
|  
+
| beginning of gene
|  
+
| noncoding strand
 
|  
 
|  
 
|-
 
|-

Revision as of 21:29, 10 March 2022

20.109(S22): Laboratory Fundamentals of Biological Engineering

Sp17 20.109 M1D7 chemical structure features.png

Spring 2022 schedule        FYI        Assignments        Homework        Class data        Communication        Accessibility

       M1: Drug discovery        M2: Metabolic engineering        M3: Project design       


Module 1: Drug discovery

SDS-PAGE gel images

[SDS-PAGE dropbox folder]

small molecule selections

T/R

Team small molecule #1 (enter compound ID) small molecule #2 (enter compound ID) aggregation assay results
TR Red 83079118 69269200 https://www.dropbox.com/s/7eut5ymxmiel9rp/TR_teal_red.xlsx?dl=0
TR Orange 95877382 83023303 https://docs.google.com/spreadsheets/d/1Lr5QAYY-63bOfrxuzZh1hgpHfTkCcTuU/edit?usp=sharing&ouid=103020115084669070409&rtpof=true&sd=true
TR Yellow 69269200 83079118 https://www.dropbox.com/s/ssc6b9kp7h6s7zj/20.109%20T%3AR%20Yellow%20Team%20Aggregation%20Assay%20-%20Class%20Data.xlsx?dl=0
TR Green 69269200 83079118 https://www.dropbox.com/s/fzo02lfzgo5ujwk/20109_TR_Green_Aggregation_Assay_Data.pptx?dl=0
TR Blue 69269200 83079118 https://www.dropbox.com/s/ezfjb4xt84xv59e/TR_blue.xlsx?dl=0
TR Teal 69269200 83079118 https://www.dropbox.com/scl/fi/1cs77ilahj51l51cw0j2g/TR_Teal_83079119.xlsx?dl=0&rlkey=8l1cae481k6p7p5y8290e8pu2
TR Pink 69269200 83079118
TR Purple 69269200 83079118 https://www.dropbox.com/s/lsdcuxv3y863k3z/TR_purple%20aggregation%20results.xlsx?dl=0
TR Grey 69269200 83079118 https://docs.google.com/spreadsheets/d/12ZOkOtndcb5FXAd1vvHBD4weM_FrWICbkfcykoFhrGY/edit?usp=sharing
TR White 69269200 83079118 https://www.dropbox.com/scl/fi/8x98j2r2nfq2qgwr4eura/White-Team-Aggregation-Results.xlsx?dl=0&rlkey=varbpxlx0apo8b2zkdt4kbxev

W/F

Team small molecule #1 (enter compound ID) small molecule #2 (enter compound ID) aggregation assay results
WF Red 69269200 83079118 https://mitprod-my.sharepoint.com/:x:/g/personal/mrowlett_mit_edu/EXXtvBLjG9BLtZajiE1PqbUBBkSUVd5xolqzA2KO1u1ADg?e=JjooPh
WF Orange 83079118 69269200 https://www.dropbox.com/s/8ksmmtml3e673m5/WFOrange%20Aggregation%20Assay%20Data.xlsx?dl=0
WF Yellow 83079118 69269200 https://www.dropbox.com/scl/fi/cotyaashmbv0vrz7wfral/Aggregation-Analysis.xlsx?dl=0&rlkey=r3r8isia4mk6vmy29a5usdykq
WF Green 83079118 83023303 https://www.dropbox.com/s/u38arbolq8zn3xq/20220218_agg_assay_yellow_green%202.xlsx?dl=0
WF Blue 69269200 83079118 https://www.dropbox.com/scl/fi/zogoszln7ydo10em8b196/20220218_agg_assay_blue-83079118.xlsx?dl=0&rlkey=glixenu1uqfo6xa5t1fmvmi08
WF Pink 83079118 69269200 https://docs.google.com/spreadsheets/d/13URd1atEq8Aqa6Ur_RrGyESe3g_RDVHK/edit?usp=sharing&ouid=107012858600740729039&rtpof=true&sd=true
WF Purple 69269200 83079118 https://docs.google.com/spreadsheets/d/1WXBr83b12vb83pYv1bqTUPl5VGFIDap9uOjESwOH0tQ/edit?usp=sharing
WF White 69269200 83023303 https://www.dropbox.com/s/c2g5513td5fepee/Aggregation%20Data.xlsx?dl=0

Aggregation Results

[T/R Aggregation dropbox folder]


Localization Results

[Localization Dropbox folder]

Module 2: Metabolic engineering

Diagnostic Digest gels

[T/R diagnostic digest folder ]

sgRNA_target sequences

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target coding or non-coding strand Ethanol / Acetate Assay Results
TR Red Acetate (A) aceE gagtttcgatcggatccacgtcatt beginning of gene target coding strand
TR Orange
TR Yellow Ethanol (E) pta-ack GTTTTTTTAGCCACGTATCAATTAT -35 region noncoding strand
TR Green Ethanol (E) aceE TTATTCCTTATCTATCTAATAACGT -30 region coding strand
TR Blue Acetate aceE GTCGCGAGTTTCGATCGGATCCACG beginning of gene coding strand
TR Teal Acetate aceE CGTCATTTGGGAAACGTTCT beginning of gene coding strand
TR Pink
TR Purple Ethanol pta GTAGGGATCAGCATAATAATAC beginning of gene noncoding strand
TR Grey Ethanol aceE CGTCATTTGGGAAACGTTCTGACAT beginning of gene noncoding strand
TR White

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target coding or non-coding strand Colorimetric Assay Results
WF Red
WF Orange
WF Yellow
WF Green
WF Blue
WF Teal
WF Pink
WF Purple
WF Grey
WF White