Difference between revisions of "20.109(F19):Class data"
From Course Wiki
Becky Meyer (Talk | contribs) (→M1D6) |
(→Module 1: Measuring genomic instability) |
||
Line 62: | Line 62: | ||
| WF Team | | WF Team | ||
| [[Media:CometChip Data WF.xlsx | WF Team Data]] | | [[Media:CometChip Data WF.xlsx | WF Team Data]] | ||
+ | |- | ||
+ | |} | ||
+ | ===Fermentation product and gene targeted:=== | ||
+ | |||
+ | ====T/R==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''Ethanol (E) or Acetate (A)''' | ||
+ | |'''Gene targeted by CRISPRi gRNA''' | ||
+ | |'''gRNA (DNA) sequence (without tag at 3' end)''' | ||
+ | |'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)''' | ||
+ | |'''Target template or nontemplate strand''' | ||
+ | |'''Colorimetric Assay Results''' | ||
+ | |- | ||
+ | |TR example | ||
+ | | E | ||
+ | | pta | ||
+ | | TGCGCCCGATCAGACTACGACTATC | ||
+ | | Coding region | ||
+ | | template | ||
+ | |[[File: | Raw data ]] | ||
+ | |- | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
+ | |- | ||
+ | |TR orange | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
+ | |- | ||
+ | |TR yellow | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
+ | |- | ||
+ | |TR green | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
+ | |- | ||
+ | |TR blue | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
+ | |- | ||
+ | |TR pink | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
+ | |- | ||
+ | |TR purple | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |Locus targeted: | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
+ | |} | ||
+ | |||
+ | ====W/F==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''Ethanol (E) or Acetate (A)''' | ||
+ | |'''Gene targeted by CRISPRi gRNA''' | ||
+ | |'''gRNA (DNA) sequence (without tag at 3' end)''' | ||
+ | |'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)''' | ||
+ | |'''Target template or nontemplate strand''' | ||
+ | |'''Colorimetric Assay Results''' | ||
+ | |- | ||
+ | |WF team | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |[[File: | Raw data ]] | ||
|- | |- | ||
|} | |} |
Revision as of 14:36, 10 October 2019
Contents
Module 1: Measuring genomic instability
M1D5
gamma-H2AX analysis
Team | Upload, then link the completed excel spreadsheet from the wiki here! |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Team | WF Team Data |
M1D6
Comet Chip analysis
Team | |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Team | WF Team Data |
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR example | E | pta | TGCGCCCGATCAGACTACGACTATC | Coding region | template | [[File: | Raw data ]] |
[[File: | Raw data ]] | ||||||
TR orange | [[File: | Raw data ]] | |||||
TR yellow | [[File: | Raw data ]] | |||||
TR green | [[File: | Raw data ]] | |||||
TR blue | [[File: | Raw data ]] | |||||
TR pink | [[File: | Raw data ]] | |||||
TR purple | Locus targeted: | [[File: | Raw data ]] |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF team | [[File: | Raw data ]] |