20.109(F19):Class data
From Course Wiki
Revision as of 18:25, 10 October 2019 by Apolonia Gardner (Talk | contribs)
Contents
Module 1: Measuring genomic instability
M1D5
gamma-H2AX analysis
Team | Upload, then link the completed excel spreadsheet from the wiki here! |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Team | WF Team Data |
M1D6
Comet Chip analysis
Team | |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Team | WF Team Data |
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR example | E | pta | TGCGCCCGATCAGACTACGACTATC | Coding region | template | [[File: | Raw data ]] |
TR orange | [[File: | Raw data ]] | |||||
TR yellow | [[File: | Raw data ]] | |||||
TR green | E | pta-ack | [[File: | Raw data ]] | |||
TR blue | ache | [[File: | Raw data ]] | ||||
TR pink | [[File: | Raw data ]] | |||||
TR purple | [[File: | Raw data ]] |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF team | [[File: | Raw data ]] |