http://measurebiology.org/w/api.php?action=feedcontributions&user=Becky+Meyer&feedformat=atomCourse Wiki - User contributions [en]2024-03-28T14:25:35ZUser contributionsMediaWiki 1.22.3http://measurebiology.org/wiki/20.109(S24):Spring_2024_schedule20.109(S24):Spring 2024 schedule2024-03-22T18:56:49Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
Welcome to 20.109! It is our goal to make this class a useful and fun introduction to the experiments and techniques used in biological engineering. Though there is not enough time to show you everything needed to do research, after this class you will feel confident and familiar with some fundamental experimental approaches and laboratory protocols. You will develop good habits at the bench, which will increase the likelihood of success in your work and ensure the health and safety of you and your labmates. By the end of the semester, you will also be well-versed in good scientific practices - through your experience with scientific writing, notebook keeping, and orally presenting data and novel ideas. All of us involved in teaching 20.109 hope you will find it a satisfying challenge and an exciting experience that has lasting value.<br />
<br />
<font color= #2f9b91 >'''SCHEDULE DETAILS:'''</font color><br><br />
<font color= #3bc2b6 >'''Lecture times:'''</font color> Tuesday (T) and Thursday (R) 11 - 12 pm in 4-237<br><br />
<font color= #3bc2b6 >'''Laboratory section times:'''</font color> Tuesday (T) and Thursday (R) 1 - 5 pm or Wednesday (W) and Friday (F) 1 - 5 pm in 56-322<br><br />
<br />
<font color= #2f9b91 >'''ABSENCE POLICY:'''</font color><br><br />
<font color= #3bc2b6 >'''Absences from lecture:'''</font color> Attendance will be recorded for participation points throughout the semester. If absent, student is responsible for all information provided in lecture. <br><br />
<font color= #3bc2b6 >'''Absences from laboratory:'''</font color> Excused absences should be discussed with the Instructors as soon as possible. Because make-up laboratory time is not provided, attendance in another section may be required to complete the necessary experiments. Unexcused absences will result in a 1/3 of a letter grade deduction from the final grade on the major assignment for the module (for example, a B+ would become a B).<br />
<br />
{| border=1px<br />
|'''MODULE'''<br />
|'''DATE'''<br />
|'''LECTURER'''<br />
|'''LABORATORY EXPERIMENTS'''<br />
|'''ASSIGNMENTS'''<br />
|--<br />
| <br />
| T/W Feb 6/7 <br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [[Media:Sp24 Orientation lecture student.pdf| Lecture slides]]<br />
| [[20.109(S24):Laboratory tour | Orientation and laboratory tour]]<br> [[Media:Sp24 EHS slides.pdf | EHS slides]]<br>[[Media:Sp24 M0 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M0_jz.pdf| WF prelab slides]]<br />
|<br />
|--<br />
| M1D1<br />
| R/F Feb 8/9<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L1 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D1 | Complete in-silico cloning of protein expression vector]]<br> [[Media:Sp24 M1D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D1 jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Orientation quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D1|Homework due]]<br />
|--<br />
| M1D2<br />
| T/W Feb 13/14 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> <br />
| [[20.109(S24):M1D2 |Purify expressed protein]] <br> [[Media:Sp24 M1D2 nll.pdf| TR prelab slides]] & [https://www.dropbox.com/scl/fi/qq54ep8nhjhwk5xy80x5l/Protein-Purification-Demo.mp4?rlkey=h00htz57i5tt2y9hz8qpieily&dl=0| Protein purification video] <br>[[Media:Sp24 M1D2 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D2|Homework due]]<br />
|--<br />
| M1D3<br />
| R/F Feb 15/16 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L2 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D3 |Assess purity and concentration of expressed protein]] <br> [[Media:Sp24 M1D3 nll.pdf| TR prelab slides]] <br> [[Media:Sp24 M1D3 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D3|Homework due]]<br />
|--<br />
| <br />
| T/W Feb 20/21<br />
| <br />
| <font color = #e1452f>'''President's Day holiday'''</font color><br />
| <br />
|--<br />
| M1D4<br />
| R/F Feb 22/23<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L3 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D4 |Review results of small molecule microarray (SMM) screen]] <br> [[Media:Sp24 M1D4 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M1D4_jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D4|Homework due]]<br />
|--<br />
| M1D5<br />
| T/W Feb 27/28<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L4 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D5 |Setup differential scanning flourimetry (DSF) experiment]] <br> [[Media:Sp24 M1D5v2 nll.pdf| TR prelab slides]]<br>[[Media:Sp24_M1D5_jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D5|Homework due]] <br> <br />
|--<br />
| M1D6<br />
| R/F Feb/Mar 29/1<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L6 2024 short.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D6 |Prepare cells for electromobility shift assay (EMSA)]] <br> [[Media:Sp24 M1D6 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M1D6 jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D6|Homework due]] <br> [[20.109(S24):Research talk| <font color = #2f9b91>'''Research talk due'''</font color>]] Mon, Mar 4 at 10pm <br><br />
|--<br />
| M1D7<br />
| T/W Mar 5/6<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L7 2024 .pptx| Lecture slides]]<br />
| [[20.109(S24):M1D7 |Complete EMSA experiment]] <br> [[Media:Sp24 M1D7 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D7 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D7|Homework due]] <br />
|--<br />
| M1D8<br />
| R/F Mar 7/8<br />
| BE Comm Lab <br> <br />
| [[20.109(S24):M1D8 |Evaluate experimental results]] <br> [[Media:Sp24 M1D8v2 nll.pdf| TR & WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D8|Homework due]] <br />
|--<br />
| M2D1<br />
| T/W Mar 12/13<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> [[Media:Sp24 M2L1.pdf| Lecture slides]] <br />
| [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> [[Media:Sp24 M2D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M2D1 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D1|Homework due]] <br />
|--<br />
| M2D2<br />
| R/F Mar 14/15<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm<br />
|--<br />
| M2D3<br />
| T/W Mar 19/20<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]<br> [[Media:Sp24_M2D3_jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br> <br />
|--<br />
| M2D4<br />
| R/F Mar 21/22 <br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L3 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> [[Media:Sp24 TR JADiscussion bcm.pdf |TR prelab slides]] <br> [[Media:UpdateSp24 WF JADiscussion bcm.pdf | WF prelab]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Mar 26/27 - R/F Mar 28/29 </font color><br />
| <br />
| <font color = #e1452f>'''Spring Break'''</font color><br />
| [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary revision due'''</font color>]] Mon, Mar 25 at 10 pm <br> <br />
|--<br />
|<br />
| T/W Apr 2/3<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
|<br />
|--<br />
| <br />
| R/F Apr 4/5<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, Apr 6 at 10 pm<br />
|--<br />
| M2D5<br />
| T/W Apr 9/10<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| M2D6<br />
| R/F Apr 11/12<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Apr 16/17 </font color><br />
| <br />
| <font color = #e1452f>'''Patriots' Day holiday'''</font color><br />
| <br />
|--<br />
| M2D7<br />
| R/F Apr 18/19<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> <br />
| [[20.109(S24):M2D7 | Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br> <br />
| [[20.109(S24):Homework#Due_M2D7|Homework due]]<br />
|--<br />
| M2D8<br />
| T/W Apr 23/24<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D8|Homework due]]<br />
|--<br />
| M3D1<br />
| R/F Apr 25/26<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br> <br />
| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br><br />
|--<br />
| M3D2<br />
| T/W Apr/May 30/1<br />
| BE Comm Lab<br />
| [[20.109(S24):M3D2 |Pitch research proposal presentation ideas ]] <br> <br />
| [[20.109(S24):Research article| <font color = #2f9b91>'''Research article due'''</font color>]] Mon, Apr 29 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Tue, Apr 30 at 10 pm<br />
|--<br />
| M3D3<br />
| R/F May 2/3<br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D3 |Develop ideas for Research proposal presentation ]] <br> <br />
| [[20.109(S24):Homework#Due_M3D3|Homework due]]<br><br />
|--<br />
| M3D4<br />
| T/W May 7/8<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D4 |Participate in Research proposal peer reviews]] <br> <br />
| [[20.109(S24):Homework#Due_M3D4|Homework due]]<br />
|--<br />
| <br />
| R/F May 9/10<br />
| <br />
| [[20.109(S24):Research proposal presentation| <font color = #2f9b91>'''Research proposal presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, May 11 at 10 pm<br />
|--<br />
| <br />
| T May 14<br />
| <font color = #e1452f>'''Celebration lunch!'''</font color> <br><br />
| <br />
| <br />
|}<br />
</div></div>Becky Meyerhttp://measurebiology.org/wiki/File:UpdateSp24_WF_JADiscussion_bcm.pdfFile:UpdateSp24 WF JADiscussion bcm.pdf2024-03-22T18:56:15Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Spring_2024_schedule20.109(S24):Spring 2024 schedule2024-03-22T17:40:31Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
Welcome to 20.109! It is our goal to make this class a useful and fun introduction to the experiments and techniques used in biological engineering. Though there is not enough time to show you everything needed to do research, after this class you will feel confident and familiar with some fundamental experimental approaches and laboratory protocols. You will develop good habits at the bench, which will increase the likelihood of success in your work and ensure the health and safety of you and your labmates. By the end of the semester, you will also be well-versed in good scientific practices - through your experience with scientific writing, notebook keeping, and orally presenting data and novel ideas. All of us involved in teaching 20.109 hope you will find it a satisfying challenge and an exciting experience that has lasting value.<br />
<br />
<font color= #2f9b91 >'''SCHEDULE DETAILS:'''</font color><br><br />
<font color= #3bc2b6 >'''Lecture times:'''</font color> Tuesday (T) and Thursday (R) 11 - 12 pm in 4-237<br><br />
<font color= #3bc2b6 >'''Laboratory section times:'''</font color> Tuesday (T) and Thursday (R) 1 - 5 pm or Wednesday (W) and Friday (F) 1 - 5 pm in 56-322<br><br />
<br />
<font color= #2f9b91 >'''ABSENCE POLICY:'''</font color><br><br />
<font color= #3bc2b6 >'''Absences from lecture:'''</font color> Attendance will be recorded for participation points throughout the semester. If absent, student is responsible for all information provided in lecture. <br><br />
<font color= #3bc2b6 >'''Absences from laboratory:'''</font color> Excused absences should be discussed with the Instructors as soon as possible. Because make-up laboratory time is not provided, attendance in another section may be required to complete the necessary experiments. Unexcused absences will result in a 1/3 of a letter grade deduction from the final grade on the major assignment for the module (for example, a B+ would become a B).<br />
<br />
{| border=1px<br />
|'''MODULE'''<br />
|'''DATE'''<br />
|'''LECTURER'''<br />
|'''LABORATORY EXPERIMENTS'''<br />
|'''ASSIGNMENTS'''<br />
|--<br />
| <br />
| T/W Feb 6/7 <br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [[Media:Sp24 Orientation lecture student.pdf| Lecture slides]]<br />
| [[20.109(S24):Laboratory tour | Orientation and laboratory tour]]<br> [[Media:Sp24 EHS slides.pdf | EHS slides]]<br>[[Media:Sp24 M0 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M0_jz.pdf| WF prelab slides]]<br />
|<br />
|--<br />
| M1D1<br />
| R/F Feb 8/9<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L1 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D1 | Complete in-silico cloning of protein expression vector]]<br> [[Media:Sp24 M1D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D1 jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Orientation quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D1|Homework due]]<br />
|--<br />
| M1D2<br />
| T/W Feb 13/14 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> <br />
| [[20.109(S24):M1D2 |Purify expressed protein]] <br> [[Media:Sp24 M1D2 nll.pdf| TR prelab slides]] & [https://www.dropbox.com/scl/fi/qq54ep8nhjhwk5xy80x5l/Protein-Purification-Demo.mp4?rlkey=h00htz57i5tt2y9hz8qpieily&dl=0| Protein purification video] <br>[[Media:Sp24 M1D2 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D2|Homework due]]<br />
|--<br />
| M1D3<br />
| R/F Feb 15/16 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L2 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D3 |Assess purity and concentration of expressed protein]] <br> [[Media:Sp24 M1D3 nll.pdf| TR prelab slides]] <br> [[Media:Sp24 M1D3 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D3|Homework due]]<br />
|--<br />
| <br />
| T/W Feb 20/21<br />
| <br />
| <font color = #e1452f>'''President's Day holiday'''</font color><br />
| <br />
|--<br />
| M1D4<br />
| R/F Feb 22/23<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L3 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D4 |Review results of small molecule microarray (SMM) screen]] <br> [[Media:Sp24 M1D4 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M1D4_jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D4|Homework due]]<br />
|--<br />
| M1D5<br />
| T/W Feb 27/28<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L4 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D5 |Setup differential scanning flourimetry (DSF) experiment]] <br> [[Media:Sp24 M1D5v2 nll.pdf| TR prelab slides]]<br>[[Media:Sp24_M1D5_jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D5|Homework due]] <br> <br />
|--<br />
| M1D6<br />
| R/F Feb/Mar 29/1<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L6 2024 short.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D6 |Prepare cells for electromobility shift assay (EMSA)]] <br> [[Media:Sp24 M1D6 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M1D6 jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D6|Homework due]] <br> [[20.109(S24):Research talk| <font color = #2f9b91>'''Research talk due'''</font color>]] Mon, Mar 4 at 10pm <br><br />
|--<br />
| M1D7<br />
| T/W Mar 5/6<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L7 2024 .pptx| Lecture slides]]<br />
| [[20.109(S24):M1D7 |Complete EMSA experiment]] <br> [[Media:Sp24 M1D7 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D7 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D7|Homework due]] <br />
|--<br />
| M1D8<br />
| R/F Mar 7/8<br />
| BE Comm Lab <br> <br />
| [[20.109(S24):M1D8 |Evaluate experimental results]] <br> [[Media:Sp24 M1D8v2 nll.pdf| TR & WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D8|Homework due]] <br />
|--<br />
| M2D1<br />
| T/W Mar 12/13<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> [[Media:Sp24 M2L1.pdf| Lecture slides]] <br />
| [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> [[Media:Sp24 M2D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M2D1 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D1|Homework due]] <br />
|--<br />
| M2D2<br />
| R/F Mar 14/15<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm<br />
|--<br />
| M2D3<br />
| T/W Mar 19/20<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]<br> [[Media:Sp24_M2D3_jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br> <br />
|--<br />
| M2D4<br />
| R/F Mar 21/22 <br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L3 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> [[Media:Sp24 TR JADiscussion bcm.pdf |TR prelab slides]] <br> [[Media:Sp24 WF JADiscussion bcm.pdf | WF prelab]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Mar 26/27 - R/F Mar 28/29 </font color><br />
| <br />
| <font color = #e1452f>'''Spring Break'''</font color><br />
| [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary revision due'''</font color>]] Mon, Mar 25 at 10 pm <br> <br />
|--<br />
|<br />
| T/W Apr 2/3<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
|<br />
|--<br />
| <br />
| R/F Apr 4/5<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, Apr 6 at 10 pm<br />
|--<br />
| M2D5<br />
| T/W Apr 9/10<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| M2D6<br />
| R/F Apr 11/12<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Apr 16/17 </font color><br />
| <br />
| <font color = #e1452f>'''Patriots' Day holiday'''</font color><br />
| <br />
|--<br />
| M2D7<br />
| R/F Apr 18/19<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> <br />
| [[20.109(S24):M2D7 | Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br> <br />
| [[20.109(S24):Homework#Due_M2D7|Homework due]]<br />
|--<br />
| M2D8<br />
| T/W Apr 23/24<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D8|Homework due]]<br />
|--<br />
| M3D1<br />
| R/F Apr 25/26<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br> <br />
| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br><br />
|--<br />
| M3D2<br />
| T/W Apr/May 30/1<br />
| BE Comm Lab<br />
| [[20.109(S24):M3D2 |Pitch research proposal presentation ideas ]] <br> <br />
| [[20.109(S24):Research article| <font color = #2f9b91>'''Research article due'''</font color>]] Mon, Apr 29 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Tue, Apr 30 at 10 pm<br />
|--<br />
| M3D3<br />
| R/F May 2/3<br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D3 |Develop ideas for Research proposal presentation ]] <br> <br />
| [[20.109(S24):Homework#Due_M3D3|Homework due]]<br><br />
|--<br />
| M3D4<br />
| T/W May 7/8<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D4 |Participate in Research proposal peer reviews]] <br> <br />
| [[20.109(S24):Homework#Due_M3D4|Homework due]]<br />
|--<br />
| <br />
| R/F May 9/10<br />
| <br />
| [[20.109(S24):Research proposal presentation| <font color = #2f9b91>'''Research proposal presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, May 11 at 10 pm<br />
|--<br />
| <br />
| T May 14<br />
| <font color = #e1452f>'''Celebration lunch!'''</font color> <br><br />
| <br />
| <br />
|}<br />
</div></div>Becky Meyerhttp://measurebiology.org/wiki/File:Sp24_WF_JADiscussion_bcm.pdfFile:Sp24 WF JADiscussion bcm.pdf2024-03-22T17:40:06Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/File:Sp24_TR_JADiscussion_bcm.pdfFile:Sp24 TR JADiscussion bcm.pdf2024-03-22T17:38:59Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Spring_2024_schedule20.109(S24):Spring 2024 schedule2024-03-21T15:11:53Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
Welcome to 20.109! It is our goal to make this class a useful and fun introduction to the experiments and techniques used in biological engineering. Though there is not enough time to show you everything needed to do research, after this class you will feel confident and familiar with some fundamental experimental approaches and laboratory protocols. You will develop good habits at the bench, which will increase the likelihood of success in your work and ensure the health and safety of you and your labmates. By the end of the semester, you will also be well-versed in good scientific practices - through your experience with scientific writing, notebook keeping, and orally presenting data and novel ideas. All of us involved in teaching 20.109 hope you will find it a satisfying challenge and an exciting experience that has lasting value.<br />
<br />
<font color= #2f9b91 >'''SCHEDULE DETAILS:'''</font color><br><br />
<font color= #3bc2b6 >'''Lecture times:'''</font color> Tuesday (T) and Thursday (R) 11 - 12 pm in 4-237<br><br />
<font color= #3bc2b6 >'''Laboratory section times:'''</font color> Tuesday (T) and Thursday (R) 1 - 5 pm or Wednesday (W) and Friday (F) 1 - 5 pm in 56-322<br><br />
<br />
<font color= #2f9b91 >'''ABSENCE POLICY:'''</font color><br><br />
<font color= #3bc2b6 >'''Absences from lecture:'''</font color> Attendance will be recorded for participation points throughout the semester. If absent, student is responsible for all information provided in lecture. <br><br />
<font color= #3bc2b6 >'''Absences from laboratory:'''</font color> Excused absences should be discussed with the Instructors as soon as possible. Because make-up laboratory time is not provided, attendance in another section may be required to complete the necessary experiments. Unexcused absences will result in a 1/3 of a letter grade deduction from the final grade on the major assignment for the module (for example, a B+ would become a B).<br />
<br />
{| border=1px<br />
|'''MODULE'''<br />
|'''DATE'''<br />
|'''LECTURER'''<br />
|'''LABORATORY EXPERIMENTS'''<br />
|'''ASSIGNMENTS'''<br />
|--<br />
| <br />
| T/W Feb 6/7 <br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [[Media:Sp24 Orientation lecture student.pdf| Lecture slides]]<br />
| [[20.109(S24):Laboratory tour | Orientation and laboratory tour]]<br> [[Media:Sp24 EHS slides.pdf | EHS slides]]<br>[[Media:Sp24 M0 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M0_jz.pdf| WF prelab slides]]<br />
|<br />
|--<br />
| M1D1<br />
| R/F Feb 8/9<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L1 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D1 | Complete in-silico cloning of protein expression vector]]<br> [[Media:Sp24 M1D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D1 jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Orientation quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D1|Homework due]]<br />
|--<br />
| M1D2<br />
| T/W Feb 13/14 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> <br />
| [[20.109(S24):M1D2 |Purify expressed protein]] <br> [[Media:Sp24 M1D2 nll.pdf| TR prelab slides]] & [https://www.dropbox.com/scl/fi/qq54ep8nhjhwk5xy80x5l/Protein-Purification-Demo.mp4?rlkey=h00htz57i5tt2y9hz8qpieily&dl=0| Protein purification video] <br>[[Media:Sp24 M1D2 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D2|Homework due]]<br />
|--<br />
| M1D3<br />
| R/F Feb 15/16 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L2 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D3 |Assess purity and concentration of expressed protein]] <br> [[Media:Sp24 M1D3 nll.pdf| TR prelab slides]] <br> [[Media:Sp24 M1D3 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D3|Homework due]]<br />
|--<br />
| <br />
| T/W Feb 20/21<br />
| <br />
| <font color = #e1452f>'''President's Day holiday'''</font color><br />
| <br />
|--<br />
| M1D4<br />
| R/F Feb 22/23<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L3 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D4 |Review results of small molecule microarray (SMM) screen]] <br> [[Media:Sp24 M1D4 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M1D4_jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D4|Homework due]]<br />
|--<br />
| M1D5<br />
| T/W Feb 27/28<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L4 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D5 |Setup differential scanning flourimetry (DSF) experiment]] <br> [[Media:Sp24 M1D5v2 nll.pdf| TR prelab slides]]<br>[[Media:Sp24_M1D5_jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D5|Homework due]] <br> <br />
|--<br />
| M1D6<br />
| R/F Feb/Mar 29/1<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L6 2024 short.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D6 |Prepare cells for electromobility shift assay (EMSA)]] <br> [[Media:Sp24 M1D6 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M1D6 jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D6|Homework due]] <br> [[20.109(S24):Research talk| <font color = #2f9b91>'''Research talk due'''</font color>]] Mon, Mar 4 at 10pm <br><br />
|--<br />
| M1D7<br />
| T/W Mar 5/6<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L7 2024 .pptx| Lecture slides]]<br />
| [[20.109(S24):M1D7 |Complete EMSA experiment]] <br> [[Media:Sp24 M1D7 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D7 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D7|Homework due]] <br />
|--<br />
| M1D8<br />
| R/F Mar 7/8<br />
| BE Comm Lab <br> <br />
| [[20.109(S24):M1D8 |Evaluate experimental results]] <br> [[Media:Sp24 M1D8v2 nll.pdf| TR & WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D8|Homework due]] <br />
|--<br />
| M2D1<br />
| T/W Mar 12/13<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> [[Media:Sp24 M2L1.pdf| Lecture slides]] <br />
| [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> [[Media:Sp24 M2D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M2D1 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D1|Homework due]] <br />
|--<br />
| M2D2<br />
| R/F Mar 14/15<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm<br />
|--<br />
| M2D3<br />
| T/W Mar 19/20<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]<br> [[Media:Sp24_M2D3_jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br> <br />
|--<br />
| M2D4<br />
| R/F Mar 21/22 <br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L3 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Mar 26/27 - R/F Mar 28/29 </font color><br />
| <br />
| <font color = #e1452f>'''Spring Break'''</font color><br />
| [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary revision due'''</font color>]] Mon, Mar 25 at 10 pm <br> <br />
|--<br />
|<br />
| T/W Apr 2/3<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
|<br />
|--<br />
| <br />
| R/F Apr 4/5<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, Apr 6 at 10 pm<br />
|--<br />
| M2D5<br />
| T/W Apr 9/10<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| M2D6<br />
| R/F Apr 11/12<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Apr 16/17 </font color><br />
| <br />
| <font color = #e1452f>'''Patriots' Day holiday'''</font color><br />
| <br />
|--<br />
| M2D7<br />
| R/F Apr 18/19<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> <br />
| [[20.109(S24):M2D7 | Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br> <br />
| [[20.109(S24):Homework#Due_M2D7|Homework due]]<br />
|--<br />
| M2D8<br />
| T/W Apr 23/24<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D8|Homework due]]<br />
|--<br />
| M3D1<br />
| R/F Apr 25/26<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br> <br />
| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br><br />
|--<br />
| M3D2<br />
| T/W Apr/May 30/1<br />
| BE Comm Lab<br />
| [[20.109(S24):M3D2 |Pitch research proposal presentation ideas ]] <br> <br />
| [[20.109(S24):Research article| <font color = #2f9b91>'''Research article due'''</font color>]] Mon, Apr 29 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Tue, Apr 30 at 10 pm<br />
|--<br />
| M3D3<br />
| R/F May 2/3<br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D3 |Develop ideas for Research proposal presentation ]] <br> <br />
| [[20.109(S24):Homework#Due_M3D3|Homework due]]<br><br />
|--<br />
| M3D4<br />
| T/W May 7/8<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D4 |Participate in Research proposal peer reviews]] <br> <br />
| [[20.109(S24):Homework#Due_M3D4|Homework due]]<br />
|--<br />
| <br />
| R/F May 9/10<br />
| <br />
| [[20.109(S24):Research proposal presentation| <font color = #2f9b91>'''Research proposal presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, May 11 at 10 pm<br />
|--<br />
| <br />
| T May 14<br />
| <font color = #e1452f>'''Celebration lunch!'''</font color> <br><br />
| <br />
| <br />
|}<br />
</div></div>Becky Meyerhttp://measurebiology.org/wiki/File:Sp24_L3_AMB.pdfFile:Sp24 L3 AMB.pdf2024-03-21T15:11:14Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/File:QD_20.109_Sp_2024_lecture_3.pptxFile:QD 20.109 Sp 2024 lecture 3.pptx2024-03-21T15:10:31Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Spring_2024_schedule20.109(S24):Spring 2024 schedule2024-03-19T17:25:06Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
Welcome to 20.109! It is our goal to make this class a useful and fun introduction to the experiments and techniques used in biological engineering. Though there is not enough time to show you everything needed to do research, after this class you will feel confident and familiar with some fundamental experimental approaches and laboratory protocols. You will develop good habits at the bench, which will increase the likelihood of success in your work and ensure the health and safety of you and your labmates. By the end of the semester, you will also be well-versed in good scientific practices - through your experience with scientific writing, notebook keeping, and orally presenting data and novel ideas. All of us involved in teaching 20.109 hope you will find it a satisfying challenge and an exciting experience that has lasting value.<br />
<br />
<font color= #2f9b91 >'''SCHEDULE DETAILS:'''</font color><br><br />
<font color= #3bc2b6 >'''Lecture times:'''</font color> Tuesday (T) and Thursday (R) 11 - 12 pm in 4-237<br><br />
<font color= #3bc2b6 >'''Laboratory section times:'''</font color> Tuesday (T) and Thursday (R) 1 - 5 pm or Wednesday (W) and Friday (F) 1 - 5 pm in 56-322<br><br />
<br />
<font color= #2f9b91 >'''ABSENCE POLICY:'''</font color><br><br />
<font color= #3bc2b6 >'''Absences from lecture:'''</font color> Attendance will be recorded for participation points throughout the semester. If absent, student is responsible for all information provided in lecture. <br><br />
<font color= #3bc2b6 >'''Absences from laboratory:'''</font color> Excused absences should be discussed with the Instructors as soon as possible. Because make-up laboratory time is not provided, attendance in another section may be required to complete the necessary experiments. Unexcused absences will result in a 1/3 of a letter grade deduction from the final grade on the major assignment for the module (for example, a B+ would become a B).<br />
<br />
{| border=1px<br />
|'''MODULE'''<br />
|'''DATE'''<br />
|'''LECTURER'''<br />
|'''LABORATORY EXPERIMENTS'''<br />
|'''ASSIGNMENTS'''<br />
|--<br />
| <br />
| T/W Feb 6/7 <br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [[Media:Sp24 Orientation lecture student.pdf| Lecture slides]]<br />
| [[20.109(S24):Laboratory tour | Orientation and laboratory tour]]<br> [[Media:Sp24 EHS slides.pdf | EHS slides]]<br>[[Media:Sp24 M0 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M0_jz.pdf| WF prelab slides]]<br />
|<br />
|--<br />
| M1D1<br />
| R/F Feb 8/9<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L1 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D1 | Complete in-silico cloning of protein expression vector]]<br> [[Media:Sp24 M1D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D1 jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Orientation quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D1|Homework due]]<br />
|--<br />
| M1D2<br />
| T/W Feb 13/14 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> <br />
| [[20.109(S24):M1D2 |Purify expressed protein]] <br> [[Media:Sp24 M1D2 nll.pdf| TR prelab slides]] & [https://www.dropbox.com/scl/fi/qq54ep8nhjhwk5xy80x5l/Protein-Purification-Demo.mp4?rlkey=h00htz57i5tt2y9hz8qpieily&dl=0| Protein purification video] <br>[[Media:Sp24 M1D2 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D2|Homework due]]<br />
|--<br />
| M1D3<br />
| R/F Feb 15/16 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L2 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D3 |Assess purity and concentration of expressed protein]] <br> [[Media:Sp24 M1D3 nll.pdf| TR prelab slides]] <br> [[Media:Sp24 M1D3 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D3|Homework due]]<br />
|--<br />
| <br />
| T/W Feb 20/21<br />
| <br />
| <font color = #e1452f>'''President's Day holiday'''</font color><br />
| <br />
|--<br />
| M1D4<br />
| R/F Feb 22/23<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L3 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D4 |Review results of small molecule microarray (SMM) screen]] <br> [[Media:Sp24 M1D4 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M1D4_jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D4|Homework due]]<br />
|--<br />
| M1D5<br />
| T/W Feb 27/28<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L4 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D5 |Setup differential scanning flourimetry (DSF) experiment]] <br> [[Media:Sp24 M1D5v2 nll.pdf| TR prelab slides]]<br>[[Media:Sp24_M1D5_jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D5|Homework due]] <br> <br />
|--<br />
| M1D6<br />
| R/F Feb/Mar 29/1<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L6 2024 short.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D6 |Prepare cells for electromobility shift assay (EMSA)]] <br> [[Media:Sp24 M1D6 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M1D6 jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D6|Homework due]] <br> [[20.109(S24):Research talk| <font color = #2f9b91>'''Research talk due'''</font color>]] Mon, Mar 4 at 10pm <br><br />
|--<br />
| M1D7<br />
| T/W Mar 5/6<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L7 2024 .pptx| Lecture slides]]<br />
| [[20.109(S24):M1D7 |Complete EMSA experiment]] <br> [[Media:Sp24 M1D7 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D7 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D7|Homework due]] <br />
|--<br />
| M1D8<br />
| R/F Mar 7/8<br />
| BE Comm Lab <br> <br />
| [[20.109(S24):M1D8 |Evaluate experimental results]] <br> [[Media:Sp24 M1D8v2 nll.pdf| TR & WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D8|Homework due]] <br />
|--<br />
| M2D1<br />
| T/W Mar 12/13<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> [[Media:Sp24 M2L1.pdf| Lecture slides]] <br />
| [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> [[Media:Sp24 M2D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M2D1 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D1|Homework due]] <br />
|--<br />
| M2D2<br />
| R/F Mar 14/15<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm<br />
|--<br />
| M2D3<br />
| T/W Mar 19/20<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br> <br />
|--<br />
| M2D4<br />
| R/F Mar 21/22 <br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Mar 26/27 - R/F Mar 28/29 </font color><br />
| <br />
| <font color = #e1452f>'''Spring Break'''</font color><br />
| [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary revision due'''</font color>]] Mon, Mar 25 at 10 pm <br> <br />
|--<br />
|<br />
| T/W Apr 2/3<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
|<br />
|--<br />
| <br />
| R/F Apr 4/5<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, Apr 6 at 10 pm<br />
|--<br />
| M2D5<br />
| T/W Apr 9/10<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| M2D6<br />
| R/F Apr 11/12<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Apr 16/17 </font color><br />
| <br />
| <font color = #e1452f>'''Patriots' Day holiday'''</font color><br />
| <br />
|--<br />
| M2D7<br />
| R/F Apr 18/19<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> <br />
| [[20.109(S24):M2D7 | Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br> <br />
| [[20.109(S24):Homework#Due_M2D7|Homework due]]<br />
|--<br />
| M2D8<br />
| T/W Apr 23/24<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D8|Homework due]]<br />
|--<br />
| M3D1<br />
| R/F Apr 25/26<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br> <br />
| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br><br />
|--<br />
| M3D2<br />
| T/W Apr/May 30/1<br />
| BE Comm Lab<br />
| [[20.109(S24):M3D2 |Pitch research proposal presentation ideas ]] <br> <br />
| [[20.109(S24):Research article| <font color = #2f9b91>'''Research article due'''</font color>]] Mon, Apr 29 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Tue, Apr 30 at 10 pm<br />
|--<br />
| M3D3<br />
| R/F May 2/3<br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D3 |Develop ideas for Research proposal presentation ]] <br> <br />
| [[20.109(S24):Homework#Due_M3D3|Homework due]]<br><br />
|--<br />
| M3D4<br />
| T/W May 7/8<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D4 |Participate in Research proposal peer reviews]] <br> <br />
| [[20.109(S24):Homework#Due_M3D4|Homework due]]<br />
|--<br />
| <br />
| R/F May 9/10<br />
| <br />
| [[20.109(S24):Research proposal presentation| <font color = #2f9b91>'''Research proposal presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, May 11 at 10 pm<br />
|--<br />
| <br />
| T May 14<br />
| <font color = #e1452f>'''Celebration lunch!'''</font color> <br><br />
| <br />
| <br />
|}<br />
</div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Spring_2024_schedule20.109(S24):Spring 2024 schedule2024-03-19T17:24:39Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
Welcome to 20.109! It is our goal to make this class a useful and fun introduction to the experiments and techniques used in biological engineering. Though there is not enough time to show you everything needed to do research, after this class you will feel confident and familiar with some fundamental experimental approaches and laboratory protocols. You will develop good habits at the bench, which will increase the likelihood of success in your work and ensure the health and safety of you and your labmates. By the end of the semester, you will also be well-versed in good scientific practices - through your experience with scientific writing, notebook keeping, and orally presenting data and novel ideas. All of us involved in teaching 20.109 hope you will find it a satisfying challenge and an exciting experience that has lasting value.<br />
<br />
<font color= #2f9b91 >'''SCHEDULE DETAILS:'''</font color><br><br />
<font color= #3bc2b6 >'''Lecture times:'''</font color> Tuesday (T) and Thursday (R) 11 - 12 pm in 4-237<br><br />
<font color= #3bc2b6 >'''Laboratory section times:'''</font color> Tuesday (T) and Thursday (R) 1 - 5 pm or Wednesday (W) and Friday (F) 1 - 5 pm in 56-322<br><br />
<br />
<font color= #2f9b91 >'''ABSENCE POLICY:'''</font color><br><br />
<font color= #3bc2b6 >'''Absences from lecture:'''</font color> Attendance will be recorded for participation points throughout the semester. If absent, student is responsible for all information provided in lecture. <br><br />
<font color= #3bc2b6 >'''Absences from laboratory:'''</font color> Excused absences should be discussed with the Instructors as soon as possible. Because make-up laboratory time is not provided, attendance in another section may be required to complete the necessary experiments. Unexcused absences will result in a 1/3 of a letter grade deduction from the final grade on the major assignment for the module (for example, a B+ would become a B).<br />
<br />
{| border=1px<br />
|'''MODULE'''<br />
|'''DATE'''<br />
|'''LECTURER'''<br />
|'''LABORATORY EXPERIMENTS'''<br />
|'''ASSIGNMENTS'''<br />
|--<br />
| <br />
| T/W Feb 6/7 <br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [[Media:Sp24 Orientation lecture student.pdf| Lecture slides]]<br />
| [[20.109(S24):Laboratory tour | Orientation and laboratory tour]]<br> [[Media:Sp24 EHS slides.pdf | EHS slides]]<br>[[Media:Sp24 M0 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M0_jz.pdf| WF prelab slides]]<br />
|<br />
|--<br />
| M1D1<br />
| R/F Feb 8/9<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L1 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D1 | Complete in-silico cloning of protein expression vector]]<br> [[Media:Sp24 M1D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D1 jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Orientation quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D1|Homework due]]<br />
|--<br />
| M1D2<br />
| T/W Feb 13/14 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> <br />
| [[20.109(S24):M1D2 |Purify expressed protein]] <br> [[Media:Sp24 M1D2 nll.pdf| TR prelab slides]] & [https://www.dropbox.com/scl/fi/qq54ep8nhjhwk5xy80x5l/Protein-Purification-Demo.mp4?rlkey=h00htz57i5tt2y9hz8qpieily&dl=0| Protein purification video] <br>[[Media:Sp24 M1D2 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D2|Homework due]]<br />
|--<br />
| M1D3<br />
| R/F Feb 15/16 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L2 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D3 |Assess purity and concentration of expressed protein]] <br> [[Media:Sp24 M1D3 nll.pdf| TR prelab slides]] <br> [[Media:Sp24 M1D3 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D3|Homework due]]<br />
|--<br />
| <br />
| T/W Feb 20/21<br />
| <br />
| <font color = #e1452f>'''President's Day holiday'''</font color><br />
| <br />
|--<br />
| M1D4<br />
| R/F Feb 22/23<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L3 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D4 |Review results of small molecule microarray (SMM) screen]] <br> [[Media:Sp24 M1D4 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M1D4_jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D4|Homework due]]<br />
|--<br />
| M1D5<br />
| T/W Feb 27/28<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L4 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D5 |Setup differential scanning flourimetry (DSF) experiment]] <br> [[Media:Sp24 M1D5v2 nll.pdf| TR prelab slides]]<br>[[Media:Sp24_M1D5_jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D5|Homework due]] <br> <br />
|--<br />
| M1D6<br />
| R/F Feb/Mar 29/1<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L6 2024 short.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D6 |Prepare cells for electromobility shift assay (EMSA)]] <br> [[Media:Sp24 M1D6 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M1D6 jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D6|Homework due]] <br> [[20.109(S24):Research talk| <font color = #2f9b91>'''Research talk due'''</font color>]] Mon, Mar 4 at 10pm <br><br />
|--<br />
| M1D7<br />
| T/W Mar 5/6<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L7 2024 .pptx| Lecture slides]]<br />
| [[20.109(S24):M1D7 |Complete EMSA experiment]] <br> [[Media:Sp24 M1D7 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D7 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D7|Homework due]] <br />
|--<br />
| M1D8<br />
| R/F Mar 7/8<br />
| BE Comm Lab <br> <br />
| [[20.109(S24):M1D8 |Evaluate experimental results]] <br> [[Media:Sp24 M1D8v2 nll.pdf| TR & WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D8|Homework due]] <br />
|--<br />
| M2D1<br />
| T/W Mar 12/13<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> [[Media:Sp24 M2L1.pdf| Lecture slides]] <br />
| [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> [[Media:Sp24 M2D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M2D1 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D1|Homework due]] <br />
|--<br />
| M2D2<br />
| R/F Mar 14/15<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm<br />
|--<br />
| M2D3<br />
| T/W Mar 19/20<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> [[Media:Sp24 M2D3 nll.pdf|TR prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br> <br />
|--<br />
| M2D4<br />
| R/F Mar 21/22 <br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Mar 26/27 - R/F Mar 28/29 </font color><br />
| <br />
| <font color = #e1452f>'''Spring Break'''</font color><br />
| [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary revision due'''</font color>]] Mon, Mar 25 at 10 pm <br> <br />
|--<br />
|<br />
| T/W Apr 2/3<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
|<br />
|--<br />
| <br />
| R/F Apr 4/5<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, Apr 6 at 10 pm<br />
|--<br />
| M2D5<br />
| T/W Apr 9/10<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| M2D6<br />
| R/F Apr 11/12<br />
| [http://be.mit.edu/directory/angela-belcher AMB] <br> <br />
| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Apr 16/17 </font color><br />
| <br />
| <font color = #e1452f>'''Patriots' Day holiday'''</font color><br />
| <br />
|--<br />
| M2D7<br />
| R/F Apr 18/19<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> <br />
| [[20.109(S24):M2D7 | Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br> <br />
| [[20.109(S24):Homework#Due_M2D7|Homework due]]<br />
|--<br />
| M2D8<br />
| T/W Apr 23/24<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D8|Homework due]]<br />
|--<br />
| M3D1<br />
| R/F Apr 25/26<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br> <br />
| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br><br />
|--<br />
| M3D2<br />
| T/W Apr/May 30/1<br />
| BE Comm Lab<br />
| [[20.109(S24):M3D2 |Pitch research proposal presentation ideas ]] <br> <br />
| [[20.109(S24):Research article| <font color = #2f9b91>'''Research article due'''</font color>]] Mon, Apr 29 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Tue, Apr 30 at 10 pm<br />
|--<br />
| M3D3<br />
| R/F May 2/3<br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D3 |Develop ideas for Research proposal presentation ]] <br> <br />
| [[20.109(S24):Homework#Due_M3D3|Homework due]]<br><br />
|--<br />
| M3D4<br />
| T/W May 7/8<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D4 |Participate in Research proposal peer reviews]] <br> <br />
| [[20.109(S24):Homework#Due_M3D4|Homework due]]<br />
|--<br />
| <br />
| R/F May 9/10<br />
| <br />
| [[20.109(S24):Research proposal presentation| <font color = #2f9b91>'''Research proposal presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, May 11 at 10 pm<br />
|--<br />
| <br />
| T May 14<br />
| <font color = #e1452f>'''Celebration lunch!'''</font color> <br><br />
| <br />
| <br />
|}<br />
</div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Spring_2024_schedule20.109(S24):Spring 2024 schedule2024-03-19T15:09:46Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
Welcome to 20.109! It is our goal to make this class a useful and fun introduction to the experiments and techniques used in biological engineering. Though there is not enough time to show you everything needed to do research, after this class you will feel confident and familiar with some fundamental experimental approaches and laboratory protocols. You will develop good habits at the bench, which will increase the likelihood of success in your work and ensure the health and safety of you and your labmates. By the end of the semester, you will also be well-versed in good scientific practices - through your experience with scientific writing, notebook keeping, and orally presenting data and novel ideas. All of us involved in teaching 20.109 hope you will find it a satisfying challenge and an exciting experience that has lasting value.<br />
<br />
<font color= #2f9b91 >'''SCHEDULE DETAILS:'''</font color><br><br />
<font color= #3bc2b6 >'''Lecture times:'''</font color> Tuesday (T) and Thursday (R) 11 - 12 pm in 4-237<br><br />
<font color= #3bc2b6 >'''Laboratory section times:'''</font color> Tuesday (T) and Thursday (R) 1 - 5 pm or Wednesday (W) and Friday (F) 1 - 5 pm in 56-322<br><br />
<br />
<font color= #2f9b91 >'''ABSENCE POLICY:'''</font color><br><br />
<font color= #3bc2b6 >'''Absences from lecture:'''</font color> Attendance will be recorded for participation points throughout the semester. If absent, student is responsible for all information provided in lecture. <br><br />
<font color= #3bc2b6 >'''Absences from laboratory:'''</font color> Excused absences should be discussed with the Instructors as soon as possible. Because make-up laboratory time is not provided, attendance in another section may be required to complete the necessary experiments. Unexcused absences will result in a 1/3 of a letter grade deduction from the final grade on the major assignment for the module (for example, a B+ would become a B).<br />
<br />
{| border=1px<br />
|'''MODULE'''<br />
|'''DATE'''<br />
|'''LECTURER'''<br />
|'''LABORATORY EXPERIMENTS'''<br />
|'''ASSIGNMENTS'''<br />
|--<br />
| <br />
| T/W Feb 6/7 <br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [[Media:Sp24 Orientation lecture student.pdf| Lecture slides]]<br />
| [[20.109(S24):Laboratory tour | Orientation and laboratory tour]]<br> [[Media:Sp24 EHS slides.pdf | EHS slides]]<br>[[Media:Sp24 M0 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M0_jz.pdf| WF prelab slides]]<br />
|<br />
|--<br />
| M1D1<br />
| R/F Feb 8/9<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L1 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D1 | Complete in-silico cloning of protein expression vector]]<br> [[Media:Sp24 M1D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D1 jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Orientation quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D1|Homework due]]<br />
|--<br />
| M1D2<br />
| T/W Feb 13/14 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> <br />
| [[20.109(S24):M1D2 |Purify expressed protein]] <br> [[Media:Sp24 M1D2 nll.pdf| TR prelab slides]] & [https://www.dropbox.com/scl/fi/qq54ep8nhjhwk5xy80x5l/Protein-Purification-Demo.mp4?rlkey=h00htz57i5tt2y9hz8qpieily&dl=0| Protein purification video] <br>[[Media:Sp24 M1D2 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D2|Homework due]]<br />
|--<br />
| M1D3<br />
| R/F Feb 15/16 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L2 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D3 |Assess purity and concentration of expressed protein]] <br> [[Media:Sp24 M1D3 nll.pdf| TR prelab slides]] <br> [[Media:Sp24 M1D3 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D3|Homework due]]<br />
|--<br />
| <br />
| T/W Feb 20/21<br />
| <br />
| <font color = #e1452f>'''President's Day holiday'''</font color><br />
| <br />
|--<br />
| M1D4<br />
| R/F Feb 22/23<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L3 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D4 |Review results of small molecule microarray (SMM) screen]] <br> [[Media:Sp24 M1D4 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M1D4_jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D4|Homework due]]<br />
|--<br />
| M1D5<br />
| T/W Feb 27/28<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L4 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D5 |Setup differential scanning flourimetry (DSF) experiment]] <br> [[Media:Sp24 M1D5v2 nll.pdf| TR prelab slides]]<br>[[Media:Sp24_M1D5_jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D5|Homework due]] <br> <br />
|--<br />
| M1D6<br />
| R/F Feb/Mar 29/1<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L6 2024 short.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D6 |Prepare cells for electromobility shift assay (EMSA)]] <br> [[Media:Sp24 M1D6 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M1D6 jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D6|Homework due]] <br> [[20.109(S24):Research talk| <font color = #2f9b91>'''Research talk due'''</font color>]] Mon, Mar 4 at 10pm <br><br />
|--<br />
| M1D7<br />
| T/W Mar 5/6<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L7 2024 .pptx| Lecture slides]]<br />
| [[20.109(S24):M1D7 |Complete EMSA experiment]] <br> [[Media:Sp24 M1D7 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D7 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D7|Homework due]] <br />
|--<br />
| M1D8<br />
| R/F Mar 7/8<br />
| BE Comm Lab <br> <br />
| [[20.109(S24):M1D8 |Evaluate experimental results]] <br> [[Media:Sp24 M1D8v2 nll.pdf| TR & WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D8|Homework due]] <br />
|--<br />
| M2D1<br />
| T/W Mar 12/13<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> [[Media:Sp24 M2L1.pdf| Lecture slides]] <br />
| [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> [[Media:Sp24 M2D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M2D1 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D1|Homework due]] <br />
|--<br />
| M2D2<br />
| R/F Mar 14/15<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> [[Media:20170602-GeorgeSun for 20.109 sp 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> [[Media:Sp24 M2D2 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M2D2 nll.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm<br />
|--<br />
| M2D3<br />
| T/W Mar 19/20<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> [[Media:Sp24 L2 AMB.pdf | Lecture slides]]<br />
| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> <br />
| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br> <br />
|--<br />
| M2D4<br />
| R/F Mar 21/22 <br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Mar 26/27 - R/F Mar 28/29 </font color><br />
| <br />
| <font color = #e1452f>'''Spring Break'''</font color><br />
| [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary revision due'''</font color>]] Mon, Mar 25 at 10 pm <br> <br />
|--<br />
|<br />
| T/W Apr 2/3<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
|<br />
|--<br />
| <br />
| R/F Apr 4/5<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, Apr 6 at 10 pm<br />
|--<br />
| M2D5<br />
| T/W Apr 9/10<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| M2D6<br />
| R/F Apr 11/12<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Apr 16/17 </font color><br />
| <br />
| <font color = #e1452f>'''Patriots' Day holiday'''</font color><br />
| <br />
|--<br />
| M2D7<br />
| R/F Apr 18/19<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> <br />
| [[20.109(S24):M2D7 | Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br> <br />
| [[20.109(S24):Homework#Due_M2D7|Homework due]]<br />
|--<br />
| M2D8<br />
| T/W Apr 23/24<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D8|Homework due]]<br />
|--<br />
| M3D1<br />
| R/F Apr 25/26<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br> <br />
| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br><br />
|--<br />
| M3D2<br />
| T/W Apr/May 30/1<br />
| BE Comm Lab<br />
| [[20.109(S24):M3D2 |Pitch research proposal presentation ideas ]] <br> <br />
| [[20.109(S24):Research article| <font color = #2f9b91>'''Research article due'''</font color>]] Mon, Apr 29 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Tue, Apr 30 at 10 pm<br />
|--<br />
| M3D3<br />
| R/F May 2/3<br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D3 |Develop ideas for Research proposal presentation ]] <br> <br />
| [[20.109(S24):Homework#Due_M3D3|Homework due]]<br><br />
|--<br />
| M3D4<br />
| T/W May 7/8<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D4 |Participate in Research proposal peer reviews]] <br> <br />
| [[20.109(S24):Homework#Due_M3D4|Homework due]]<br />
|--<br />
| <br />
| R/F May 9/10<br />
| <br />
| [[20.109(S24):Research proposal presentation| <font color = #2f9b91>'''Research proposal presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, May 11 at 10 pm<br />
|--<br />
| <br />
| T May 14<br />
| <font color = #e1452f>'''Celebration lunch!'''</font color> <br><br />
| <br />
| <br />
|}<br />
</div></div>Becky Meyerhttp://measurebiology.org/wiki/File:Sp24_L2_AMB.pdfFile:Sp24 L2 AMB.pdf2024-03-19T15:08:30Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D420.109(S24):M2D42024-03-18T19:59:00Z<p>Becky Meyer: /* Part 2: Participate in Communication Lab workshop */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
Today you will analyze data produced by Sanger sequencing of your mini-preps. In the sequencing section of the wiki yesterday, you added primers to your purified plasmids in order to amplify the section of plasmid which hopefully holds your insert. At the sequencing facility, the DNA plasmid and primer mixture was incubated with polymerase and dNTPs (deoxynucleotides). As part of a PCR reaction, the primer will bind to the complementary site on the plasmid and extend the nascent chain with base pairs, utilizing the appropriate dNTP. The sequencing facility also includes a set of fluorescently labeled ddNTPs (dideoxynucleotides). When these are incorporated, they will terminate the nascent chain because no new base can be linked. The resulting DNA fragment will end with a fluorophore corresponding with the final ddNTP base added. As the ddNTP is incorporated randomly during the extension process, the resulting pool of DNA fragments are over different sizes. These fragments are sorted by size and passed by a fluroescent detector. Because the fragments are in order of size, the unique fluorophores detected indicate the order of bases in the DNA sequence. <br />
<br />
Sanger sequencing facilities will return two files for every reaction sequenced. The "sequencing file" which has the translated sequence ready to computationally align to the known template, and the "ab1 file" which shows a chromatograph of the sequencing. The chromatograph shows color-coded fluroescent read peaks which correspond with the ddNTP fluorophores. This raw data is then converted into the sequencing file. It is always good practice to examine the chromatograph of your sequencing data to determine the quality of the sequencing, and therefore the confidence of the called bases in your sequencing file. Today you will examine the sequencing chromatographs for quality control and align your sequencing files to determine which clone you mini-prepped contains your desired insert.<br />
<br />
[[Image:Sp24 sanger sequencing.png|thumb|700px|center| '''Detection steps in Sanger sequencing.''' Created by Samara Ona for Biorender]]<br />
<br />
==Protocols==<br />
<br />
===Part 1: Examine clone sequencing results===<br />
<br />
Your goal in this section is to analyze the sequencing data for you two YSD peptide clones - two independent colonies from your cloning reaction - and then decide which colony to proceed with to engineer yeast to become a cadmium sink. <br />
<br />
'''Retrieve cloning sequence results from Genewiz'''<br />
<br />
#Your sequencing data is available from [http://genewiz.com Genewiz]. For easier access, the information was uploaded to the [20.109(S24):Class_data Class Data tab].<br />
#Download the zip folder with your team sequencing results and confirm that there are 8 files saved in the folder.<br />
#For each sequencing reaction, you should have one .ab1 file and one .seq file.<br />
#Open one of the .ab1 files.<br />
#*This file contains the chromatogram for your sequencing reaction. Scroll through the sequence and ensure that the peaks are clearly defined and evenly spaced. Low signal (or peaks) or stacked peaks can provide incorrect base assignments in the sequence.<br />
#Open one of the .seq files.<br />
#*This file contains the base assignments for your sequencing reaction. The bases are assigned by the software from the chromatogram sequence.<br />
#*The start of the a sequencing reaction result often contains several Ns, which indicates that the software was unable to assign a basepair. <br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Given the chromatogram result, why might the software assign Ns in the start of the sequence?<br />
*Visually inspect the chromatograms for all of your sequencing results. <br />
**Do the peaks appear clearly defined or is there overlap? What might this indicate about the quality of your sequencing results?<br />
**Do the peaks extend above the background signal? What might this indicate about the quality of your sequencing results?<br />
<br />
'''Confirm insertion sequence using SnapGene'''<br><br />
<br />
You should align your sequencing data with a known sequence, in this case the DNA sequence encoding your peptide of interest from M2D1, to identify a successful insertion. There are several web-based programs for aligning sequences and still more programs that can be purchased. The steps for using SnapGene are below. Please feel free to use any program with which you are familiar. <br />
<br />
#Generate a new DNA file that contains the insertion sequence you generated on M2D1. <br />
#Generate an additional new DNA file that contains the results from the sequencing reaction completed by Genewiz.<br />
#*For each sequencing result you should generate a distinct new DNA file. Remember you should have a forward and reverse sequencing result for each of your clones!<br />
#*Paste the sequence text from your sequencing run into the new DNA file window. If there were ambiguous areas of your sequencing results, these will be listed as "N" rather than "A" "T" "G" or "C" and it's fine to include Ns in the query. <br />
#*The start and end of your sequencing may have several Ns. In this case it is best to omit these Ns by pasting only the 'good' sequence that is flanked by the ambiguous sequence.<br />
#To confirm the mutation sequence in your clones, open one of the forward sequencing results files generated in the previous step.<br />
#*Select 'Tools' --> 'Align to Reference DNA Sequence...' --> 'Align Full Sequences...' from the toolbar.<br />
#*In the window, select the file that contains the insertion oligo sequence and click 'Open'.<br />
#A new window will open with the alignment of the two sequences. The top line of sequence shows the results of the sequencing reaction and the bottom line shows the oligo you designed.<br />
#*Are there any discrepancies or differences between the two sequences? Scroll through the entire alignment to check the full sequencing result and note any basepair changes.<br />
#Follow the above steps to examine all of your sequencing results. '''Remember: you used a forward and a reverse primer to check for insertion.'''<br />
#From the alignments, determine which clone has your insert.<br />
#*If both clones contain the correct sequence choose either yeast transformation to use in the rest of your experiments. If only one is correct, then this is the transformant you will use. If neither of your plasmids carry the appropriate mutation, talk to your Instructor. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Attach a screenshot for each alignment.<br />
*Record which clone contains the insert.<br />
<br />
===Part 2: Participate in Communication Lab workshop===<br />
<br />
Our communication instructor, Dr. Chiara Ricci-Tam, will join us today for a discussion on oral presentations. We will also have an intensive workshop on preparing for your journal article presentation as part of this extended workshop.<br />
<br />
You will get a chance to practice your slide and script from homework as part of this Comm Lab.<br />
<br />
==Reagents list==<br />
*Snapgene software<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D5 |Perform flow cytometry and harvest cells to test cadmium sequestration]] <br><br />
Previous day: [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D320.109(S24):M2D32024-03-18T16:02:53Z<p>Becky Meyer: /* Part 3: Prepare plasmid clones for sequencing analysis */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
==Introduction==<br />
<br />
In the previous laboratory session, you performed the procedure used to generate the hexapeptide display plasmids. Today, we will confirm that the cloning worked and transform the plasmids into our &#x394;Met17 yeast to test the functionality of the peptides. We are able to move our peptide display plasmid between organisms because we are using a "shuttle vector" to express the DNA. The shuttle vector has features that allow it to be selectively expressed in both bacteria and yeast.<br />
<br />
In order to confirm cloning and create purified plasmid for yeast transformation, we need to isolate hexapeptide plasmids from the E. coli system used to amplify a single plasmid clone generated during the last class. To purify the plasmid, we will perform a mini-prep. This plasmid preparation protocol uses alkaline lysis to separate the plasmid DNA from the chromosomal DNA and cellular debris, allowing the plasmid DNA to be studied further. The key difference between plasmid DNA and chromosomal DNA is size and this difference is what is used to separate the two components.<br />
[[Image:Qiagen_alkalinelysis.jpg|thumb|right|450px|'''Schematic of alkaline lysis: Blue DNA genomic and red DNA plasmid. Image by Qiagen''']] <br />
In this protocol the media is removed from the cells by centrifugation. The cells are first resuspended in a solution that contains Tris, to buffer the cells, and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. Second, an alkaline lysis buffer containing sodium hydroxide and the detergent sodium dodecyl sulfate (SDS) is added. The base denatures the cell’s DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. Third. the pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. The DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The smaller plasmid DNA renatures normally and stays in solution, effectively separating plasmid DNA from the chromosomal DNA and the proteins and lipids of the cell. At this point the solution is spun at a high speed and soluble fraction, including the plasmid, is kept for further purification and the insoluble fraction, the macromolecules and chromosomal DNA is pelleted and thrown away. Following these steps there are several more washes to purify the plasmid DNA but the major purification work, separating the plasmid from the chromosomal DNA and cell lysate, is completed by the three steps shown in the figure.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Mini-prep peptide clones===<br />
<br />
The procedure for DNA isolation using small volumes is commonly termed "mini-prep," which distinguishes it from a “maxi-prep” that involves a larger volume of cells and additional steps of purification. The overall goal of each prep is the same -- to separate the plasmid DNA from the chromosomal DNA and cellular debris. In the traditional mini-prep protocol, the media is removed from the cells by centrifugation. The cells are resuspended in a solution that contains Tris to buffer the cells and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. A solution of sodium hydroxide and sodium dodecyl sulfate (SDS) is then added. The base denatures the DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. The pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. In addition, the DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The plasmid DNA renatures normally and stays in solution. Thus plasmid DNA got effectively separated from chromosomal DNA and proteins and lipids of the cell. <br />
<br />
Today you will use a kit that relies on a column to collect the renatured plasmid DNA. The silica gel column interacts with the DNA while allowing contaminants to pass through the column. This interaction is aided by chaotropic salts and ethanol, which are added in the buffers. The ethanol dehydrates the DNA backbone allowing the chaotropic salts to form a salt bridge between the silica and the DNA.<br />
<br />
For timing reasons, two colonies from the spread plates you prepared in the previous laboratory session were inoculated into LB/Amp and grown overnight at 37&deg;C on a rotator.<br />
<br />
#Retrieve your two cultures from the font laboratory bench. Label two eppendorf tubes to reflect your samples (Clone#1 #2 #3). <br />
#Vortex the bacterial cultures and pour ~1.5 mL of each into the appropriate eppendorf tube. [[Image:Removing cells.jpg|thumb|right|200px|'''Diagram showing how to aspirate the supernatant.''' Be careful to remove as few cells as possible.]] <br />
#Balance the tubes in the microfuge, spin them at maximum speed for 2 min, and remove the supernatants with the vacuum aspirator.<br />
#Pour another 1.5 mL of each culture into the appropriate eppendorf tube (add the culture to the pellet previously collected), and repeat the spin step. Repeat until you use up the entire volume of culture.<br />
#Resuspend each cell pellet in 250 &mu;L buffer P1. <br />
#*Buffer P1 contains RNase so that we collect only our nucleic acid of interest, DNA.<br />
#Add 250 &mu;L of buffer P2 to each tube, and mix by inversion until the suspension is homogeneous. About 4-6 inversions of the tube should suffice. You may incubate here for '''up to 5 minutes, but not more'''.<br />
#*Buffer P2 contains sodium hydroxide for lysing. <br />
#Add 350 &mu;L buffer N3 to each tube, and mix '''immediately''' by inversion (4-10 times).<br />
#*Buffer N3 contains acetic acid, which will cause the chromosomal DNA to messily precipitate; the faster you invert, the more homogeneous the precipitation will be.<br />
#*Buffer N3 also contains a chaotropic salt in preparation for the silica column purification.<br />
#Centrifuge for 10 minutes at maximum speed. Note that you will be saving the '''supernatant''' after this step.<br />
#*Meanwhile, prepare 2 labeled QIAprep columns, one for each candidate clone, and 2 trimmed eppendorf tubes for the final elution step.<br />
#Transfer the entire supernatant to the column and centrifuge for 1 min. Discard the eluant into a tube labeled ''''Qiagen waste'.'''<br />
#Add 0.5 mL PB to each column, then spin for 1 min and discard the eluant into the Qiagen waste tube. <br />
#Next wash with 0.75 mL PE, with a 1 min spin step as usual. Discard the ethanol in the Qiagen waste tube.<br />
#After removing the PE, spin the mostly dry column for 1 more minute. <br />
#*It is important to remove all traces of ethanol, as they may interfere with subsequent work with the DNA.<br />
#Transfer each column insert (blue) to the trimmed eppendorf tube you prepared (cut off lid).<br />
#Add 30 &mu;L of distilled H<sub>2</sub>O pH ~8 to the top center of the column, wait 1 min, and then spin 1 min to collect your DNA.<br />
#Cap the trimmed tube or transfer elution to new eppendorf tube.<br />
#Alert the Instructor when you are ready to measure the concentration of DNA in your mini-prep.<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Record the concentration for each of the mini-prep you prepared.<br />
*Record the 260/280 ratio for of the mini-preps you prepared. What does this value indicate about the purity of the DNA in your mini-preps?<br />
<br />
===Part 2: Transform peptide display plasmid into &#x394;Met17 yeast cells===<br />
<br />
Following DNA production by competent bacteria, the next step is moving the plasmid to our yeast model system for experimentation. To do this, we create competent &#x394;Met17 cells and use a proprietary chemical transformation procedure to insert our newly created mutations. Yeast that have successfully been transformed are selected by utilizing plates that are made with synthetic dropout media, allowing only yeast expressing our plasmid to survive.<br />
<br />
During transformation, a plasmid enters a competent yeast, then replicates and expresses the encoded genes. Following the transformation procedure, a mixed population of cells exists as shown in the figure to the right: some cells did not uptake the plasmid (light blue cells) while others contain the plasmid that carries the cassette allowing for tryptophan production (dark blue cells), Because the agar plate used for selection does not contain a tyrptophan supplement, only bacterial cells that harbor the plasmid survive and reproduce to form a colony.<br />
<br />
[[Image:Yeast transformation image.jpg|thumb|right|550px|'''Schematic of yeast transformation.''' Yeast cells that harbor the plasmid (dark blue cells) are selected for using an agar plate that lacks tryptophan. Image generated using Biorender]]In the yeast plasmid system, a gene on the pYAGA expression vector encodes an ODCase cassette which catalyzes de novo synthesis of tryptophan. Thus, only transformed yeast will grow on agar plates lacking tryptophan.<br />
<br />
Most yeast do not usually exist in a “transformation ready” state, referred to as competence. Instead yeast cells are incubated with LiAc to promote competency by making the cells permeable to plasmid DNA uptake. Competent cells are extremely fragile and should be handled gently, specifically the cells should be kept cold and not vortexed. The transformation procedure is efficient enough for most lab purposes, but much lower than bacterial transformation efficiency. Bacterial efficiencies can be as high as 10<sup>9</sup> transformed cells per microgram of DNA, while yeast transformation using lithium cations tends to peak at 10<sup>6</sup> transformed cells per microgram of DNA. <br />
<br />
You will transform each of your mini-prepped plasmids into &#x394;Met17 yeast, which is the strain we will use to examine the effect of your approach on cadmium uptake. <br />
<br />
#Label two 1.5 mL eppendorf tubes with your team information and clone designation (Clone#1 and Clone#2).<br />
#Acquire an aliquot of the competent &#x394;Met17 yeast (prepared by the teaching faculty) from the front laboratory bench.<br />
#Pipet 50 &mu;L of the &#x394;Met17 competent cells into each labeled eppendorf tube.<br />
#*'''Remember:''' it is important to keep the competent cells on ice! Also, avoid over pipetting and vortexing!<br />
#Add 5 &mu;L of each clone candidate clone mini-prep to the appropriate eppendorf tube.<br />
#Add 500 &mu;L Solution 3 and mix gently by flicking the tube.<br />
#Incubate your transformation mixes at 30 &deg;C for 45 min, gently mixing 2-3 times throughout the incubation.<br />
#Once you have begun the incubation, retrieve and label one SD-U plate for each transformant. Be sure to include transformant number, your team/section, and the date on each plate.<br />
#Retrieve your transformations from the incubator and alert the teaching faculty that you are ready to plate your samples.<br />
#Plate 150&mu;L of each co-transformation onto an appropriately labeled SD-U agar plate.<br />
#*The teaching faculty will demonstrate how you should 'spread' your co-transformation onto the SD-U agar plates. You should include this procedure in your laboratory notebook.<br />
#Incubate your spread plates in the 30 &deg;C incubator for 2-4 days.<br />
<br />
===Part 3: Prepare plasmid clones for sequencing analysis===<br />
<br />
DNA sequencing will be used to confirm that the cloning is correct. The invention of automated sequencing machines has made sequence determination a relatively fast and inexpensive process. The method for sequencing DNA is not new but automation of the process is recent, developed in conjunction with the massive genome sequencing efforts of the 1990s and 2000s. At the heart of sequencing reactions is chemistry worked out by Fred Sanger in the 1970s which uses dideoxynucleotides, or chain-terminating bases. These chain-terminating bases can be added to a growing chain of DNA but cannot be further extended. Performing four reactions, each with a different chain-terminating base, generates fragments of different lengths ending at G, A, T, or C. The fragments, once separated by size, reflect the DNA sequence due to the presence of fluorescent dyes, one color linked to each dideoxy-base. The four colored fragments can be passed through capillaries to a computer that can read the output and trace the color intensities detected. <br />
<br />
[[Image:Fa20 M3D2 sanger sequencing.png|thumb|center|700px|'''Principles of Sanger sequencing.''' A. Chain-terminating bases are used to halt the DNA synthesis reaction at different lengths and attach a fluorophore that is used to determine the sequence of the DNA strand. B. The sequence of the DNA strand is determined using the fluorescent signature associated with each length of DNA in the reaction, this is visualized as a chromatogram.]]<br />
<br />
Just as amplification reactions require a primer for initiation, primers are also needed for sequencing reactions. Legible readout of the gene typically begins about 40-50 bp downstream of the primer site, and continues for ~1000 bp at most. Thus, multiple primers must be used to fully view genes > 1 kb in size. Though the target sequence for your point mutation is shorter than 1000 bp, we will sequence with both a forward and reverse primer to double-check that the sequence is correct (''i.e.'' free of unwanted mutations). Often vectors will include common features like types of promoters. Companies offering sanger sequencing services will often call these "universal primers" since they are frequently used. We will use two of these universal primers to sequence your clones.<br />
<br />
The sequences for the primers you will use to confirm your peptide insert are below:<br />
<br />
<br />
<center><br />
{| border="1"<br />
! Primer<br />
! Sequence<br />
|-<br />
| Seq1_Fwd<br />
| 5' - CCTCAACAACTAGCAAAGGC - 3'<br />
|-<br />
| M13F_Rev<br />
| 5' - GTAAAACGACGGCCAG - 3'<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
Because you will examine the peptide insert sequence in your using both a forward and a reverse primer, '''you will need to prepare two reactions for each mini-prep'''. Thus you will have a total of four sequencing reactions. For each reaction, combine the following reagents in a clearly labeled eppendorf tube:<br />
*12 &mu;L nuclease-free water<br />
*8 &mu;L of your plasmid DNA candidate<br />
*10 &mu;L of the primer stock from the front laboratory bench (the stock concentration is 5 pmol/&mu;L)<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Calculate the quantity (in ng) of DNA in each of the sequencing reactions. <br />
*Calculate the final concentration of sequencing primer in each reaction.<br />
<br />
==Reagents list==<br />
*QIAprep Spin Miniprep Kit (from Qiagen)<br />
**buffer P1<br />
**buffer P2<br />
**buffer N3<br />
**buffer PB<br />
**buffer PE<br />
*Frozen-EZ Yeast Transformation II Kit (from Zymo Research)<br />
**Solution 3<br />
*Chemically competent &#x394;Met17 yeast (genotype: ''MATa/MATα {leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15} [phi+] &#x394;met17''))<br />
*CSM-TRP plates<br />
**Complete synthetic media - tryptophan (CSM-T) media: 0.17% yeast nitrogen base without amino acid and ammonium sulfate (BD Bacto), 0.5% ammonium sulfate (Sigma), 0.13 % amino acid mix lacking tryptophan (US Biological), 2% glucose (BD Bacto), 0.1% adenine hemisulfate (Sigma)<br />
**Plates prepared by adding 2% agar (BD Bacto) to SD media<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br><br />
Previous day: [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D320.109(S24):M2D32024-03-15T17:21:02Z<p>Becky Meyer: /* Part 3: Prepare plasmid clones for sequencing analysis */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
==Introduction==<br />
<br />
In the previous laboratory session, you performed the procedure used to generate the hexapeptide display plasmids. Today, we will confirm that the cloning worked and transform the plasmids into our &#x394;Met17 yeast to test the functionality of the peptides. We are able to move our peptide display plasmid between organisms because we are using a "shuttle vector" to express the DNA. The shuttle vector has features that allow it to be selectively expressed in both bacteria and yeast.<br />
<br />
In order to confirm cloning and create purified plasmid for yeast transformation, we need to isolate hexapeptide plasmids from the E. coli system used to amplify a single plasmid clone generated during the last class. To purify the plasmid, we will perform a mini-prep. This plasmid preparation protocol uses alkaline lysis to separate the plasmid DNA from the chromosomal DNA and cellular debris, allowing the plasmid DNA to be studied further. The key difference between plasmid DNA and chromosomal DNA is size and this difference is what is used to separate the two components.<br />
[[Image:Qiagen_alkalinelysis.jpg|thumb|right|450px|'''Schematic of alkaline lysis: Blue DNA genomic and red DNA plasmid. Image by Qiagen''']] <br />
In this protocol the media is removed from the cells by centrifugation. The cells are first resuspended in a solution that contains Tris, to buffer the cells, and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. Second, an alkaline lysis buffer containing sodium hydroxide and the detergent sodium dodecyl sulfate (SDS) is added. The base denatures the cell’s DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. Third. the pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. The DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The smaller plasmid DNA renatures normally and stays in solution, effectively separating plasmid DNA from the chromosomal DNA and the proteins and lipids of the cell. At this point the solution is spun at a high speed and soluble fraction, including the plasmid, is kept for further purification and the insoluble fraction, the macromolecules and chromosomal DNA is pelleted and thrown away. Following these steps there are several more washes to purify the plasmid DNA but the major purification work, separating the plasmid from the chromosomal DNA and cell lysate, is completed by the three steps shown in the figure.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Mini-prep peptide clones===<br />
<br />
The procedure for DNA isolation using small volumes is commonly termed "mini-prep," which distinguishes it from a “maxi-prep” that involves a larger volume of cells and additional steps of purification. The overall goal of each prep is the same -- to separate the plasmid DNA from the chromosomal DNA and cellular debris. In the traditional mini-prep protocol, the media is removed from the cells by centrifugation. The cells are resuspended in a solution that contains Tris to buffer the cells and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. A solution of sodium hydroxide and sodium dodecyl sulfate (SDS) is then added. The base denatures the DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. The pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. In addition, the DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The plasmid DNA renatures normally and stays in solution. Thus plasmid DNA got effectively separated from chromosomal DNA and proteins and lipids of the cell. <br />
<br />
Today you will use a kit that relies on a column to collect the renatured plasmid DNA. The silica gel column interacts with the DNA while allowing contaminants to pass through the column. This interaction is aided by chaotropic salts and ethanol, which are added in the buffers. The ethanol dehydrates the DNA backbone allowing the chaotropic salts to form a salt bridge between the silica and the DNA.<br />
<br />
For timing reasons, two colonies from the spread plates you prepared in the previous laboratory session were inoculated into LB/Amp and grown overnight at 37&deg;C on a rotator.<br />
<br />
#Retrieve your two cultures from the font laboratory bench. Label two eppendorf tubes to reflect your samples (Clone#1 #2 #3). <br />
#Vortex the bacterial cultures and pour ~1.5 mL of each into the appropriate eppendorf tube. [[Image:Removing cells.jpg|thumb|right|200px|'''Diagram showing how to aspirate the supernatant.''' Be careful to remove as few cells as possible.]] <br />
#Balance the tubes in the microfuge, spin them at maximum speed for 2 min, and remove the supernatants with the vacuum aspirator.<br />
#Pour another 1.5 mL of each culture into the appropriate eppendorf tube (add the culture to the pellet previously collected), and repeat the spin step. Repeat until you use up the entire volume of culture.<br />
#Resuspend each cell pellet in 250 &mu;L buffer P1. <br />
#*Buffer P1 contains RNase so that we collect only our nucleic acid of interest, DNA.<br />
#Add 250 &mu;L of buffer P2 to each tube, and mix by inversion until the suspension is homogeneous. About 4-6 inversions of the tube should suffice. You may incubate here for '''up to 5 minutes, but not more'''.<br />
#*Buffer P2 contains sodium hydroxide for lysing. <br />
#Add 350 &mu;L buffer N3 to each tube, and mix '''immediately''' by inversion (4-10 times).<br />
#*Buffer N3 contains acetic acid, which will cause the chromosomal DNA to messily precipitate; the faster you invert, the more homogeneous the precipitation will be.<br />
#*Buffer N3 also contains a chaotropic salt in preparation for the silica column purification.<br />
#Centrifuge for 10 minutes at maximum speed. Note that you will be saving the '''supernatant''' after this step.<br />
#*Meanwhile, prepare 2 labeled QIAprep columns, one for each candidate clone, and 2 trimmed eppendorf tubes for the final elution step.<br />
#Transfer the entire supernatant to the column and centrifuge for 1 min. Discard the eluant into a tube labeled ''''Qiagen waste'.'''<br />
#Add 0.5 mL PB to each column, then spin for 1 min and discard the eluant into the Qiagen waste tube. <br />
#Next wash with 0.75 mL PE, with a 1 min spin step as usual. Discard the ethanol in the Qiagen waste tube.<br />
#After removing the PE, spin the mostly dry column for 1 more minute. <br />
#*It is important to remove all traces of ethanol, as they may interfere with subsequent work with the DNA.<br />
#Transfer each column insert (blue) to the trimmed eppendorf tube you prepared (cut off lid).<br />
#Add 30 &mu;L of distilled H<sub>2</sub>O pH ~8 to the top center of the column, wait 1 min, and then spin 1 min to collect your DNA.<br />
#Cap the trimmed tube or transfer elution to new eppendorf tube.<br />
#Alert the Instructor when you are ready to measure the concentration of DNA in your mini-prep.<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Record the concentration for each of the mini-prep you prepared.<br />
*Record the 260/280 ratio for of the mini-preps you prepared. What does this value indicate about the purity of the DNA in your mini-preps?<br />
<br />
===Part 2: Transform peptide display plasmid into &#x394;Met17 yeast cells===<br />
<br />
Following DNA production by competent bacteria, the next step is moving the plasmid to our yeast model system for experimentation. To do this, we create competent &#x394;Met17 cells and use a proprietary chemical transformation procedure to insert our newly created mutations. Yeast that have successfully been transformed are selected by utilizing plates that are made with synthetic dropout media, allowing only yeast expressing our plasmid to survive.<br />
<br />
During transformation, a plasmid enters a competent yeast, then replicates and expresses the encoded genes. Following the transformation procedure, a mixed population of cells exists as shown in the figure to the right: some cells did not uptake the plasmid (light blue cells) while others contain the plasmid that carries the cassette allowing for tryptophan production (dark blue cells), Because the agar plate used for selection does not contain a tyrptophan supplement, only bacterial cells that harbor the plasmid survive and reproduce to form a colony.<br />
<br />
[[Image:Yeast transformation image.jpg|thumb|right|550px|'''Schematic of yeast transformation.''' Yeast cells that harbor the plasmid (dark blue cells) are selected for using an agar plate that lacks tryptophan. Image generated using Biorender]]In the yeast plasmid system, a gene on the pYAGA expression vector encodes an ODCase cassette which catalyzes de novo synthesis of tryptophan. Thus, only transformed yeast will grow on agar plates lacking tryptophan.<br />
<br />
Most yeast do not usually exist in a “transformation ready” state, referred to as competence. Instead yeast cells are incubated with LiAc to promote competency by making the cells permeable to plasmid DNA uptake. Competent cells are extremely fragile and should be handled gently, specifically the cells should be kept cold and not vortexed. The transformation procedure is efficient enough for most lab purposes, but much lower than bacterial transformation efficiency. Bacterial efficiencies can be as high as 10<sup>9</sup> transformed cells per microgram of DNA, while yeast transformation using lithium cations tends to peak at 10<sup>6</sup> transformed cells per microgram of DNA. <br />
<br />
You will transform each of your mini-prepped plasmids into &#x394;Met17 yeast, which is the strain we will use to examine the effect of your approach on cadmium uptake. <br />
<br />
#Label two 1.5 mL eppendorf tubes with your team information and clone designation (Clone#1 and Clone#2).<br />
#Acquire an aliquot of the competent &#x394;Met17 yeast (prepared by the teaching faculty) from the front laboratory bench.<br />
#Pipet 50 &mu;L of the &#x394;Met17 competent cells into each labeled eppendorf tube.<br />
#*'''Remember:''' it is important to keep the competent cells on ice! Also, avoid over pipetting and vortexing!<br />
#Add 5 &mu;L of each clone candidate clone mini-prep to the appropriate eppendorf tube.<br />
#Add 500 &mu;L Solution 3 and mix gently by flicking the tube.<br />
#Incubate your transformation mixes at 30 &deg;C for 45 min, gently mixing 2-3 times throughout the incubation.<br />
#Once you have begun the incubation, retrieve and label one SD-U plate for each transformant. Be sure to include transformant number, your team/section, and the date on each plate.<br />
#Retrieve your transformations from the incubator and alert the teaching faculty that you are ready to plate your samples.<br />
#Plate 150&mu;L of each co-transformation onto an appropriately labeled SD-U agar plate.<br />
#*The teaching faculty will demonstrate how you should 'spread' your co-transformation onto the SD-U agar plates. You should include this procedure in your laboratory notebook.<br />
#Incubate your spread plates in the 30 &deg;C incubator for 2-4 days.<br />
<br />
===Part 3: Prepare plasmid clones for sequencing analysis===<br />
<br />
DNA sequencing will be used to confirm that the cloning is correct. The invention of automated sequencing machines has made sequence determination a relatively fast and inexpensive process. The method for sequencing DNA is not new but automation of the process is recent, developed in conjunction with the massive genome sequencing efforts of the 1990s and 2000s. At the heart of sequencing reactions is chemistry worked out by Fred Sanger in the 1970s which uses dideoxynucleotides, or chain-terminating bases. These chain-terminating bases can be added to a growing chain of DNA but cannot be further extended. Performing four reactions, each with a different chain-terminating base, generates fragments of different lengths ending at G, A, T, or C. The fragments, once separated by size, reflect the DNA sequence due to the presence of fluorescent dyes, one color linked to each dideoxy-base. The four colored fragments can be passed through capillaries to a computer that can read the output and trace the color intensities detected. <br />
<br />
[[Image:Fa20 M3D2 sanger sequencing.png|thumb|center|700px|'''Principles of Sanger sequencing.''' A. Chain-terminating bases are used to halt the DNA synthesis reaction at different lengths and attach a fluorophore that is used to determine the sequence of the DNA strand. B. The sequence of the DNA strand is determined using the fluorescent signature associated with each length of DNA in the reaction, this is visualized as a chromatogram.]]<br />
<br />
Just as amplification reactions require a primer for initiation, primers are also needed for sequencing reactions. Legible readout of the gene typically begins about 40-50 bp downstream of the primer site, and continues for ~1000 bp at most. Thus, multiple primers must be used to fully view genes > 1 kb in size. Though the target sequence for your point mutation is shorter than 1000 bp, we will sequence with both a forward and reverse primer to double-check that the sequence is correct (''i.e.'' free of unwanted mutations). Often vectors will include common features like types of promoters. Companies offering sanger sequencing services will often call these "universal primers" since they are frequently used. We will use two of these universal primers to sequence your clones.<br />
<br />
The sequences for the primers you will use to confirm your peptide insert are below:<br />
<br />
<br />
<center><br />
{| border="1"<br />
! Primer<br />
! Sequence<br />
|-<br />
| M13R_Fwd<br />
| 5' - CCTCAACAACTAGCAAAGGC - 3'<br />
|-<br />
| M13F_Fwd<br />
| 5' - GTAAAACGACGGCCAG - 3'<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
Because you will examine the peptide insert sequence in your using both a forward and a reverse primer, '''you will need to prepare two reactions for each mini-prep'''. Thus you will have a total of four sequencing reactions. For each reaction, combine the following reagents in a clearly labeled eppendorf tube:<br />
*12 &mu;L nuclease-free water<br />
*8 &mu;L of your plasmid DNA candidate<br />
*10 &mu;L of the primer stock from the front laboratory bench (the stock concentration is 5 pmol/&mu;L)<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Calculate the quantity (in ng) of DNA in each of the sequencing reactions. <br />
*Calculate the final concentration of sequencing primer in each reaction.<br />
<br />
==Reagents list==<br />
*QIAprep Spin Miniprep Kit (from Qiagen)<br />
**buffer P1<br />
**buffer P2<br />
**buffer N3<br />
**buffer PB<br />
**buffer PE<br />
*Frozen-EZ Yeast Transformation II Kit (from Zymo Research)<br />
**Solution 3<br />
*Chemically competent &#x394;Met17 yeast (genotype: ''MATa/MATα {leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15} [phi+] &#x394;met17''))<br />
*CSM-TRP plates<br />
**Complete synthetic media - tryptophan (CSM-T) media: 0.17% yeast nitrogen base without amino acid and ammonium sulfate (BD Bacto), 0.5% ammonium sulfate (Sigma), 0.13 % amino acid mix lacking tryptophan (US Biological), 2% glucose (BD Bacto), 0.1% adenine hemisulfate (Sigma)<br />
**Plates prepared by adding 2% agar (BD Bacto) to SD media<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br><br />
Previous day: [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D320.109(S24):M2D32024-03-15T16:56:57Z<p>Becky Meyer: /* Part 1: Mini-prep peptide clones */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
==Introduction==<br />
<br />
In the previous laboratory session, you performed the procedure used to generate the hexapeptide display plasmids. Today, we will confirm that the cloning worked and transform the plasmids into our &#x394;Met17 yeast to test the functionality of the peptides. We are able to move our peptide display plasmid between organisms because we are using a "shuttle vector" to express the DNA. The shuttle vector has features that allow it to be selectively expressed in both bacteria and yeast.<br />
<br />
In order to confirm cloning and create purified plasmid for yeast transformation, we need to isolate hexapeptide plasmids from the E. coli system used to amplify a single plasmid clone generated during the last class. To purify the plasmid, we will perform a mini-prep. This plasmid preparation protocol uses alkaline lysis to separate the plasmid DNA from the chromosomal DNA and cellular debris, allowing the plasmid DNA to be studied further. The key difference between plasmid DNA and chromosomal DNA is size and this difference is what is used to separate the two components.<br />
[[Image:Qiagen_alkalinelysis.jpg|thumb|right|450px|'''Schematic of alkaline lysis: Blue DNA genomic and red DNA plasmid. Image by Qiagen''']] <br />
In this protocol the media is removed from the cells by centrifugation. The cells are first resuspended in a solution that contains Tris, to buffer the cells, and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. Second, an alkaline lysis buffer containing sodium hydroxide and the detergent sodium dodecyl sulfate (SDS) is added. The base denatures the cell’s DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. Third. the pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. The DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The smaller plasmid DNA renatures normally and stays in solution, effectively separating plasmid DNA from the chromosomal DNA and the proteins and lipids of the cell. At this point the solution is spun at a high speed and soluble fraction, including the plasmid, is kept for further purification and the insoluble fraction, the macromolecules and chromosomal DNA is pelleted and thrown away. Following these steps there are several more washes to purify the plasmid DNA but the major purification work, separating the plasmid from the chromosomal DNA and cell lysate, is completed by the three steps shown in the figure.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Mini-prep peptide clones===<br />
<br />
The procedure for DNA isolation using small volumes is commonly termed "mini-prep," which distinguishes it from a “maxi-prep” that involves a larger volume of cells and additional steps of purification. The overall goal of each prep is the same -- to separate the plasmid DNA from the chromosomal DNA and cellular debris. In the traditional mini-prep protocol, the media is removed from the cells by centrifugation. The cells are resuspended in a solution that contains Tris to buffer the cells and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. A solution of sodium hydroxide and sodium dodecyl sulfate (SDS) is then added. The base denatures the DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. The pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. In addition, the DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The plasmid DNA renatures normally and stays in solution. Thus plasmid DNA got effectively separated from chromosomal DNA and proteins and lipids of the cell. <br />
<br />
Today you will use a kit that relies on a column to collect the renatured plasmid DNA. The silica gel column interacts with the DNA while allowing contaminants to pass through the column. This interaction is aided by chaotropic salts and ethanol, which are added in the buffers. The ethanol dehydrates the DNA backbone allowing the chaotropic salts to form a salt bridge between the silica and the DNA.<br />
<br />
For timing reasons, two colonies from the spread plates you prepared in the previous laboratory session were inoculated into LB/Amp and grown overnight at 37&deg;C on a rotator.<br />
<br />
#Retrieve your two cultures from the font laboratory bench. Label two eppendorf tubes to reflect your samples (Clone#1 #2 #3). <br />
#Vortex the bacterial cultures and pour ~1.5 mL of each into the appropriate eppendorf tube. [[Image:Removing cells.jpg|thumb|right|200px|'''Diagram showing how to aspirate the supernatant.''' Be careful to remove as few cells as possible.]] <br />
#Balance the tubes in the microfuge, spin them at maximum speed for 2 min, and remove the supernatants with the vacuum aspirator.<br />
#Pour another 1.5 mL of each culture into the appropriate eppendorf tube (add the culture to the pellet previously collected), and repeat the spin step. Repeat until you use up the entire volume of culture.<br />
#Resuspend each cell pellet in 250 &mu;L buffer P1. <br />
#*Buffer P1 contains RNase so that we collect only our nucleic acid of interest, DNA.<br />
#Add 250 &mu;L of buffer P2 to each tube, and mix by inversion until the suspension is homogeneous. About 4-6 inversions of the tube should suffice. You may incubate here for '''up to 5 minutes, but not more'''.<br />
#*Buffer P2 contains sodium hydroxide for lysing. <br />
#Add 350 &mu;L buffer N3 to each tube, and mix '''immediately''' by inversion (4-10 times).<br />
#*Buffer N3 contains acetic acid, which will cause the chromosomal DNA to messily precipitate; the faster you invert, the more homogeneous the precipitation will be.<br />
#*Buffer N3 also contains a chaotropic salt in preparation for the silica column purification.<br />
#Centrifuge for 10 minutes at maximum speed. Note that you will be saving the '''supernatant''' after this step.<br />
#*Meanwhile, prepare 2 labeled QIAprep columns, one for each candidate clone, and 2 trimmed eppendorf tubes for the final elution step.<br />
#Transfer the entire supernatant to the column and centrifuge for 1 min. Discard the eluant into a tube labeled ''''Qiagen waste'.'''<br />
#Add 0.5 mL PB to each column, then spin for 1 min and discard the eluant into the Qiagen waste tube. <br />
#Next wash with 0.75 mL PE, with a 1 min spin step as usual. Discard the ethanol in the Qiagen waste tube.<br />
#After removing the PE, spin the mostly dry column for 1 more minute. <br />
#*It is important to remove all traces of ethanol, as they may interfere with subsequent work with the DNA.<br />
#Transfer each column insert (blue) to the trimmed eppendorf tube you prepared (cut off lid).<br />
#Add 30 &mu;L of distilled H<sub>2</sub>O pH ~8 to the top center of the column, wait 1 min, and then spin 1 min to collect your DNA.<br />
#Cap the trimmed tube or transfer elution to new eppendorf tube.<br />
#Alert the Instructor when you are ready to measure the concentration of DNA in your mini-prep.<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Record the concentration for each of the mini-prep you prepared.<br />
*Record the 260/280 ratio for of the mini-preps you prepared. What does this value indicate about the purity of the DNA in your mini-preps?<br />
<br />
===Part 2: Transform peptide display plasmid into &#x394;Met17 yeast cells===<br />
<br />
Following DNA production by competent bacteria, the next step is moving the plasmid to our yeast model system for experimentation. To do this, we create competent &#x394;Met17 cells and use a proprietary chemical transformation procedure to insert our newly created mutations. Yeast that have successfully been transformed are selected by utilizing plates that are made with synthetic dropout media, allowing only yeast expressing our plasmid to survive.<br />
<br />
During transformation, a plasmid enters a competent yeast, then replicates and expresses the encoded genes. Following the transformation procedure, a mixed population of cells exists as shown in the figure to the right: some cells did not uptake the plasmid (light blue cells) while others contain the plasmid that carries the cassette allowing for tryptophan production (dark blue cells), Because the agar plate used for selection does not contain a tyrptophan supplement, only bacterial cells that harbor the plasmid survive and reproduce to form a colony.<br />
<br />
[[Image:Yeast transformation image.jpg|thumb|right|550px|'''Schematic of yeast transformation.''' Yeast cells that harbor the plasmid (dark blue cells) are selected for using an agar plate that lacks tryptophan. Image generated using Biorender]]In the yeast plasmid system, a gene on the pYAGA expression vector encodes an ODCase cassette which catalyzes de novo synthesis of tryptophan. Thus, only transformed yeast will grow on agar plates lacking tryptophan.<br />
<br />
Most yeast do not usually exist in a “transformation ready” state, referred to as competence. Instead yeast cells are incubated with LiAc to promote competency by making the cells permeable to plasmid DNA uptake. Competent cells are extremely fragile and should be handled gently, specifically the cells should be kept cold and not vortexed. The transformation procedure is efficient enough for most lab purposes, but much lower than bacterial transformation efficiency. Bacterial efficiencies can be as high as 10<sup>9</sup> transformed cells per microgram of DNA, while yeast transformation using lithium cations tends to peak at 10<sup>6</sup> transformed cells per microgram of DNA. <br />
<br />
You will transform each of your mini-prepped plasmids into &#x394;Met17 yeast, which is the strain we will use to examine the effect of your approach on cadmium uptake. <br />
<br />
#Label two 1.5 mL eppendorf tubes with your team information and clone designation (Clone#1 and Clone#2).<br />
#Acquire an aliquot of the competent &#x394;Met17 yeast (prepared by the teaching faculty) from the front laboratory bench.<br />
#Pipet 50 &mu;L of the &#x394;Met17 competent cells into each labeled eppendorf tube.<br />
#*'''Remember:''' it is important to keep the competent cells on ice! Also, avoid over pipetting and vortexing!<br />
#Add 5 &mu;L of each clone candidate clone mini-prep to the appropriate eppendorf tube.<br />
#Add 500 &mu;L Solution 3 and mix gently by flicking the tube.<br />
#Incubate your transformation mixes at 30 &deg;C for 45 min, gently mixing 2-3 times throughout the incubation.<br />
#Once you have begun the incubation, retrieve and label one SD-U plate for each transformant. Be sure to include transformant number, your team/section, and the date on each plate.<br />
#Retrieve your transformations from the incubator and alert the teaching faculty that you are ready to plate your samples.<br />
#Plate 150&mu;L of each co-transformation onto an appropriately labeled SD-U agar plate.<br />
#*The teaching faculty will demonstrate how you should 'spread' your co-transformation onto the SD-U agar plates. You should include this procedure in your laboratory notebook.<br />
#Incubate your spread plates in the 30 &deg;C incubator for 2-4 days.<br />
<br />
===Part 3: Prepare plasmid clones for sequencing analysis===<br />
<br />
DNA sequencing will be used to confirm that the cloning is correct. The invention of automated sequencing machines has made sequence determination a relatively fast and inexpensive process. The method for sequencing DNA is not new but automation of the process is recent, developed in conjunction with the massive genome sequencing efforts of the 1990s and 2000s. At the heart of sequencing reactions is chemistry worked out by Fred Sanger in the 1970s which uses dideoxynucleotides, or chain-terminating bases. These chain-terminating bases can be added to a growing chain of DNA but cannot be further extended. Performing four reactions, each with a different chain-terminating base, generates fragments of different lengths ending at G, A, T, or C. The fragments, once separated by size, reflect the DNA sequence due to the presence of fluorescent dyes, one color linked to each dideoxy-base. The four colored fragments can be passed through capillaries to a computer that can read the output and trace the color intensities detected. <br />
<br />
[[Image:Fa20 M3D2 sanger sequencing.png|thumb|center|700px|'''Principles of Sanger sequencing.''' A. Chain-terminating bases are used to halt the DNA synthesis reaction at different lengths and attach a fluorophore that is used to determine the sequence of the DNA strand. B. The sequence of the DNA strand is determined using the fluorescent signature associated with each length of DNA in the reaction, this is visualized as a chromatogram.]]<br />
<br />
Just as amplification reactions require a primer for initiation, primers are also needed for sequencing reactions. Legible readout of the gene typically begins about 40-50 bp downstream of the primer site, and continues for ~1000 bp at most. Thus, multiple primers must be used to fully view genes > 1 kb in size. Though the target sequence for your point mutation is shorter than 1000 bp, we will sequence with both a forward and reverse primer to double-check that the sequence is correct (''i.e.'' free of unwanted mutations). Often vectors will include common features like types of promoters. Companies offering sanger sequencing services will often call these "universal primers" since they are frequently used. We will use two of these universal primers to sequence your clones.<br />
<br />
The sequences for the primers you will use to confirm your peptide insert are below:<br />
<br />
<br />
<center><br />
{| border="1"<br />
! Primer<br />
! Sequence<br />
|-<br />
| M13R_Fwd<br />
| 5' - CAGGAAACAGCTATGAC - 3'<br />
|-<br />
| M13F_Fwd<br />
| 5' - GTAAAACGACGGCCAG - 3'<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
Because you will examine the peptide insert sequence in your using both a forward and a reverse primer, '''you will need to prepare two reactions for each mini-prep'''. Thus you will have a total of four sequencing reactions. For each reaction, combine the following reagents in a clearly labeled eppendorf tube:<br />
*12 &mu;L nuclease-free water<br />
*8 &mu;L of your plasmid DNA candidate<br />
*10 &mu;L of the primer stock from the front laboratory bench (the stock concentration is 5 pmol/&mu;L)<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Calculate the quantity (in ng) of DNA in each of the sequencing reactions. <br />
*Calculate the final concentration of sequencing primer in each reaction.<br />
<br />
==Reagents list==<br />
*QIAprep Spin Miniprep Kit (from Qiagen)<br />
**buffer P1<br />
**buffer P2<br />
**buffer N3<br />
**buffer PB<br />
**buffer PE<br />
*Frozen-EZ Yeast Transformation II Kit (from Zymo Research)<br />
**Solution 3<br />
*Chemically competent &#x394;Met17 yeast (genotype: ''MATa/MATα {leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15} [phi+] &#x394;met17''))<br />
*CSM-TRP plates<br />
**Complete synthetic media - tryptophan (CSM-T) media: 0.17% yeast nitrogen base without amino acid and ammonium sulfate (BD Bacto), 0.5% ammonium sulfate (Sigma), 0.13 % amino acid mix lacking tryptophan (US Biological), 2% glucose (BD Bacto), 0.1% adenine hemisulfate (Sigma)<br />
**Plates prepared by adding 2% agar (BD Bacto) to SD media<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br><br />
Previous day: [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D820.109(S24):M2D82024-03-12T23:22:11Z<p>Becky Meyer: /* Part 2: Complete data analysis */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
==Introduction==<br />
Today is the final laboratory session for Module 1! You have completed all of the bench work for your research; however, there is still data analysis to complete for your experiments. In addition to plotting the data, you will complete statistical analysis to determine the significance of your results.<br />
<br />
Statistics are mathematical tools used to analyze, interpret, and organize data. The specific tools that you will use are confidence intervals (CI) and the Student's ''t''-test. To begin, review the following definitions:<br />
*Mean (or average) is defined as: <br />
<br />
<br />
<center><br />
<math> \overline{\chi } = \frac{\sum_{i}^{n}\chi _{i}}{n}</math>, ''where'' <math>\chi _{i}</math> = ''individual value and n = number of samples''<br />
</center><br />
<br />
<br />
*With infinite data, the mean (<math> \overline{\chi }</math>) approaches the true mean (&mu;).<br />
*Standard deviation measures the variation in the data and is defined as:<br />
<br />
<br />
<center><br />
<math> s = \sqrt{\frac{\sum_{i}^{n }(\chi _{_{i}}-\overline{\chi })}{n - 1}}</math>, ''where n - 1 = degrees of freedom''<br />
</center><br />
<br />
<br />
*With infinite data, the standard deviation (''s'') approaches the true standard deviation (&sigma;).<br />
<br />
An assumption is made when using standard deviation to report the variation in a data set. It is assumed that sufficient data have been collected to generate a normal curve.<br />
<br />
So, what does this all mean in regard to the data you will report? As an example, if the calculated <math> \overline{\chi }</math> of a data set equals 80 au there is a 95% chance the &mu; is between 50 au and 110 au, where au = arbitrary units. And how does this relate to ''s''? If you know the &mu;, the &sigma; represents a 68% confidence interval. <br />
<br />
When interpreting data, the error bars are representative of the noise in the data or how different the data points are for each of the replicates. Replicates come in two types: technical and biological. Technical replicates indicate that the same sample was tested multiple times and is measure of experimenter error (for example, pipetting errors between aliquots). Biological replicates indicate that different preparations of the same sample were tested and is a measure of the difference in a response to a variable (for example, response to a treatment between separate cultures of the same cell line). Though both types have value in data analysis, the interpretation of the error represented in each case is different. Because of this it is important to indicate if the replicates used in the data analysis are technical or biological. For your data, what type of replicates did you analyze for the &gamma;H2AX experiment? For the CometChip experiment?<br />
<br />
Lastly, you will use Student's ''t''-test to report if your data are statistically different between treatments. <br />
*Student's ''t''-test is defined as:<br />
<br />
<br />
<center><br />
<math>t = \frac{\left | \overline{\chi_{_{1}}} - \overline{\chi_{_{2}}} \right |}{s_{pooled}}\sqrt{\frac{n_{1} n_{2}}{n_{1}+n_{2}}}</math>, ''where'' <math>s_{pooled} = \sqrt{\frac{s_{1}^{2} (n_{1} -1) + {s_{2}^{2} (n_{2} - 1)}{}}{n_{1} + n_{2} - 2}}</math><br />
</center><br />
<br />
<br />
The value you calculate with the Student's ''t''-test equation is referred to as ''t''<sub>calculated</sub>. This ''t''<sub>calculated</sub> value is compared to the ''t''<sub>tabulated</sub> value in the the ''t'' table, according to the appropriate ''n'' - 1 using the p-value for the two-tailed distribution (which assumes that you do not know how the data will shift). If the ''t''<sub>calculated</sub> value is greater than the ''t''<sub>tabulated</sub>, then the data sets are significantly different at the specific p-value. So, what does this all mean in regard to the data you will report? As an example, if the ''t''<sub>calculated</sub> for a data set with ''n'' - 1 = 10 is 3 (given that the ''t''<sub>tabulated</sub> is 2.228), then the data sets are different with a ''p''-value &le; 0.05. Which means that there is less that a 5% chance that the data sets are the same.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Practice statistical analysis===<br />
If you would like additional practice in completing statistical analysis, please complete Part 1. '''If you are confident in your understanding, please proceed to Part 2.''' <br />
<br />
Review data from an experiment where cells were exposed to increasing amounts of radiation (linked [[Media: CometAssay_M1D6stats_F14.xlsx |here]]). Your goal is to determine if a statistically significant amount of DNA damage was induced. For the purpose of this exercise, the values in the spreadsheet are in arbitrary units of 'DNA damage', where the higher numbers indicate more damage. <br />
<br />
When interpreting the statistics, consider how you may use the information to convince someone that the DNA damage was significant. You may find the spreadsheet originally created by Prof. Bevin Engelward and modified for the 20.109 laboratory, helpful for this exercise (linked [[Media: S09_20109_M2D5-Stats-4.xls |here]]). <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Attach the completed spreadsheet.<br />
**Include a bar graph of the data with standard deviations.<br />
**Indicate if there is a statistically significant difference (''i.e.'' provide a ''p''-value) between the conditions tested.<br />
<br />
===Part 2: Complete data analysis===<br />
<br />
Use the tools above to analyze the data for your ICP-OES experiments. The figures / analyses in your Data summary should include measures of variability (i.e. standard deviation) and significance (i.e. ''p''-values).<br />
<br />
'''For the ICP-OES data:'''<br />
<br />
In the analysis that you completed, you averaged the data from three replicates for each condition.<br />
<br />
===Organize figures and outline results text for your Research article===<br />
<br />
The goal for today is to focus on how you will communicate the results you are gathering and analyzing in the Research article. <br />
<br />
Currently, you have partial drafts and outlines for each of the sections (with Instructor feedback!) that will be included in the Research article. Today you will organize and write a detailed outline for the data that you collected for this module. Use the skills you learned when you completed the figure homework and apply them to the remaining figures for your Research article.<br />
<br />
To get started on this process, complete the following:<br />
<br />
#Make a list of all of the schematics / data figures / tables that will be included.<br />
#Organize the figures such that the data tell a coherent story that answers your research question.<br />
#Complete the following steps for each figure:<br />
#*Write a conclusive figure title that relays the main take-home message for the data shown.<br />
#*Write a results subsection title that mimics the figure title.<br />
#*Outline the text that will be included in the results subsection using the prompts included in the Results section of [[20.109(F21):Research_article#Results| Research article]] page.<br />
<br />
Remember: you can find the information provided during the Comm Lab workshop on the[[20.109(F21):Communication | Communication]] page for help!<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
<br />
*Include the list of schematics / data figures / tables.<br />
*For each schematic / data figure / table, provide an outline of the information that will included in the text of the results section.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S23):M3D1 | Brainstorm ideas for Research proposal presentation]] <br><br />
Previous day: [[20.109(S23):M2D7 |Confirm transporter expression and cell survival of yeast exposed to metal]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D620.109(S24):M2D62024-03-12T23:21:13Z<p>Becky Meyer: /* Reagents list */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
In this laboratory session, you will complete the penultimate experiment of this module: assessing how effective your bioremediation system is at removing cadmium from the cell media.<br />
[[Image:Sp23 Pb electrons.png|350px|right]]<br />
In the last laboratory session, you prepared samples for analysis using inductively coupled plasma optical emission spectroscopy (ICP-OES). This technique is also known as ICP-AES, with the "A" representing "atomic". With this approach, a solution containing unknown elements is dissolved in acid to create a solution of soluble elements. These elements are pumped through a nebulizer to create a consistent fine spray. Inside the chamber, a quartz torch contained in an argon-cooled induction coil is lit, leading to the generation of a stable plasma "flame" capable of reaching 10,000K (the reported temperature on the surface of the sun). <br />
<br />
As elements are aerosolized through the nebulizer, they are sprayed into the plasma where they are ionized with the electrons taking up the thermic energy emitted by the plasma and thus reaching an excited state. As the electrons fall back to ground level, they emit light at specific optical wavelengths that can be detected by the spectrometer. This approach allows us to determine the presence of elements in a sample by taking advantage of characteristic emission patterns of different elements. This data can then be processed to determine the elemental composition of samples, as well as differences in elemental concentrations between samples.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review collection of ICP-OES data===<br />
[[Image:Sp23 ICP.png|thumb|450px|right|'''ICP-OES equipment''']]Due to the training required to operate the machinery, the teaching staff and Dr. Jifa Qi have generated the ICP-OES data you will analyze. Please review the following steps to help conceptualize how the data were generated.<br />
<br />
#Enter the ICP-OES facility and place samples in fume hood while setting up the equipment.<br />
#Open the liquid argon regulator valve to begin the flow of argon gas to the ICP apparatus.<br />
#Turn on the chiller to cool the ICP apparatus during operation.<br />
#Tighten tubing connecting autosampler to nebulizer. <br />
[[Image:Sp23 ICP nebulizer.png|thumb|300px|right|'''Ion nebulizer''']][[Image:Sp24 plasma.jpg|thumb|350px|right|'''Plasma torch behind protective layers''']]<br />
#Open the ICP Expert program and temporarily boost the argon gas flow to purge the system and maintain steady gas flow.<br />
#Use the instrumentation panel in ICP Expert to light the plasma torch.<br />
#*Plasma must be burn for 20 minutes before data can be collected.<br />
#Ensure collection probe is place in rinse solution.<br />
#Place samples in autosampler.<br />
#Before beginning experimental run, verify the following conditions to ensure machine is operational.<br />
#*Periodic bubbles present in drain lines for spray chamber and autosampler.<br />
#*Stable fog present in nebulizer sample chamber.<br />
#*Stable torch flame.<br />
#Set the number of standards and samples on the autosampler map to set order of sample processing.<br />
#Set parameters of sampling as listed below:<br />
#*3 replicates per sample<br />
#*RF power = 1.2 kW<br />
#*pump speed = 12rpm<br />
#*read time = 5s<br />
#*rinse time = 30s<br />
#*stabilization time = 15s<br />
#*nebulizer flow = 0.70 L/min<br />
#*plasma flow = 12 L/min<br />
#*radial viewing mode<br />
#*viewing height = 8mm<br />
#Set element and wavelength to be tested<br />
#*If unsure of which wavelength is ideal for elements under analysis, select all available wavelengths<br />
#Save program file.<br />
#Begin ICP-OES testing program.<br />
<br />
===Part 2: Analyze ICP-OES data===<br />
ICP-OES uses replicate measurements of each sample to identify signal intensity at wavelengths previously determined to be indicative of a particular metal. It is possible to examine all available wavelengths to identify any unknown metals in a sample, or to select particular wavelengths to focus on identifying particular metals of interest. Additionally, ICP-OES allows users to calibrate measurements against known metal standards to allow for a concentration measurement (in parts per million) of each identified metal in the sample.<br />
<br />
Once a run is complete, multiple documents of data are generated to allow for detailed examination of the data. These data files have been uploaded to the '''Class Data''' tab of the wiki to allow for further analysis.<br />
#Open the file called "Sp24_ICP-OES_Detailed with Calibrations". This file contains details on the experimental parameters used to collect data, the calibration curves for each standard at each wavelength tested, and all the raw data for both standards and samples.<br />
#*One key piece of data in this file is the linear relationship between the known concentrations of iron and cadmium in the standard curve at each wavelength. The data is plotted with an R-squared value, and the calculated concentration of each standard is calculated at each wavelength.<br />
<br />
#Using this standard curve calibration data, consider the following questions and note them in your laboratory notebook.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Are there any particular wavelengths that appear entirely accurate for measuring cadmium (looking at calculated ppm and fit of the standard curve)?<br />
*Would you exclude any wavelengths from cadmium measurement based on their calibration?<br />
*Consider these same questions for iron measurement.<br />
<br />
ICP-OES is a well studied technique, and its analysis is continually being refined as new information is established. This also means that resources on best practices, and potential problems exist to guide scientists to obtain accurate results. One of these resources is linked [https://www.inorganicventures.com/periodic-table here]. This is an interactive periodic table meant to consolidate not only elemental information, but also information about potential sources of interference when using spectroscopy to identify the elemental composition of a sample. <br />
#Click on cadmium in the periodic table and scroll down to "Atomic Spectroscopic Information" located at the bottom of the right-hand panel.<br />
#*The elements listed here can be sources of interference (and therefore inaccurate measurements) at the wavelengths listed.<br />
<br />
Consider the following questions and note them in your laboratory notebook.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Do you expect to see any potential interference from other elements in your sample? If so, which wavelengths are the most likely to be affected by interference?<br />
<br />
Now that you had identified any problematic wavelengths that you want to exclude from your analysis, you can take a closer look at the data for each of the samples in the class.<br />
#From the class data page, download the csv file. This file contains the data for all samples in a format more amenable to analysis. The first sheet of this file contains the data, and the second sheet contains a key to indicate the identity of each sample.<br />
#There is a baseline control sample of untransformed &#x394;Met17 yeast for each section.<br />
#Identify the ppm for cadmium and iron for each control sample at the wavelength(s) of your choosing. Record these values in your notebook.<br />
#Identify the ppm for your group's sample for cadmium and iron at the same wavelength(s)<br />
#*What does a lower ppm indicate? (Hint: think about the experimental set up)<br />
#Record these values in your notebook.<br />
<br />
Differences in metal uptake could be accounted for by different amounts of yeast present. To account for this, you will normalize your ppm concentration for each sample to the weight of yeast in that sample. Yeast culture weight is often used in place of cell number as a normalization metric, and that is what you will use as well. <br />
<br />
However, you might remember that you have been recording optical density of your cultures at key points in the experiment. While optical density does have a relationship with cell number, it is not a perfectly linear relationship at all OD values. The relationship between optical density and cell number can also be influenced by the spectrophotometer used to establish optical density. In order to allow for normalization, the instructors have taken multiple measurements of optical density and pelleted yeast weight and used this data to generate equations that can be used to convert optical density to pellet weight. This data is attached [[Media:Sp23 Yeast OD weight relationship.xlsx |here]].<br />
<br />
Two equations are included to describe this data. While the polynomial relationship provides a better fit for a range of OD measurements, for an OD<sub>600</sub> under 2, there is a reasonable linear relationship between pellet weight and optical density. This is why you were asked to dilute your cultures to ~ OD<sub>600</sub> = 1.<br />
<br />
#Use the equation of your choosing to calculate the pellet weight for your sample. This will be used to normalize ppm reading across different samples.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Record your ppm measurements from ICP-OES.<br />
*Record pellet weight of your sample.<br />
<br />
==Reagents list==<br />
*Complete synthetic media - tryptophan + Cysteine, Methionine, and galactose (CSM-G) media: 0.17% yeast nitrogen base without amino acid and ammonium sulfate (BD Bacto), 0.5% ammonium sulfate (Sigma), 0.13 % amino acid mix lacking tryptophan (US Biologicals), 0.005% Methionine (Sigma), 0.005% Cysteine (Sigma), 2% galactose (Sigma), 0.1% adenine hemisulfate (Sigma)<br />
*Cadmium nitrate (Sigma), stock concentration= 100mM<br />
*TraceCERT cadmium standard for ICP (Sigma)<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D7 |Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br><br />
Previous day: [[20.109(S24):M2D5 |Perform flow cytometry and harvest cells to test cadmium sequestration]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D520.109(S24):M2D52024-03-12T23:19:42Z<p>Becky Meyer: /* Reagents list */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
==Protocols==<br />
===Part 1: Induce expression of YSD peptide===<br />
<br />
For timing reasons, the induction steps were completed prior to class. So you understand how the cell suspensions you will use for the metal uptake assay were created, please review the steps below.<br />
<br />
#Inoculated 5 mL of SD-R media with a colony of &#x394;Met17 cells transformed with the pYAGA containing your peptide of interest.<br />
#Incubated the culture overnight at 30 &deg;C with shaking at 220 rpm.<br />
#Dilute the overnight culture 1:10 in 10 mL of fresh SD-R media.<br />
#Incubate at 30 &deg;C for 4 hours with shaking at 220 rpm.<br />
#To induce cell surface peptide expression, pellet cells and resuspend in 10ml of SD-G media.<br />
#Incubate overnight at at 30 &deg;C with shaking at 220 rpm.<br />
<br />
=== Part 2: Stain transformed yeast to determine YSD expression ===<br />
Prior to this session, the instructors transformed ...<br />
<br />
'''Retrieve yeast culture labelled with your groups color from 30&deg;C incubator'''<br />
<br />
#Measure the optical density (OD) of your yeast on the spectrophotometer. <br />
#*You will have two samples: untransformed &#x394;Met17 yeast, and &#x394;Met17 yeast transformed with a pYAGA control plasmid expressing a peptide.<br />
#Blank the spectrophotometer with >1000 uL of CSM in a clear cuvette<br />
#*Add 900 uL of CSM to a new cuvette. Add 100 uL of your yeast culture and mix well by pipetting up and down. <br />
#*Record the OD(@600nm) of your sample by taking a measurement using the spectrophotometer and multiplying by 10 (to account for the 10x dilution). <br />
#Determine how many microliters of your sample are required to analyze 1x10<sup>6</sup> yeast cells.<br />
#*The conversion rate from OD to cells for yeast is: (10<sup>7</sup> yeast cells)/(OD x mL of culture)<br />
#*Thus, An optical density of 1 at 600nm equals 10<sup>7</sup> yeast cells per mL.<br />
#Add the correct volume of culture (calculated above) such that 10^6 yeast are added to a microcentrifuge tube for each sample. <br />
#Add an additional 900 uL of PBSA to each centrifuge tube and pellet the cells for 2 minutes in microcentrifuge at 4000xg. <br />
#Discard supernatant carefully with vacuum aspirator or with pipette (Do not touch or disturb the yeast pellet!). Wash with an additional 1 mL of PBSA, pellet, and remove supernatant. Repeat washing step once more. <br />
#Add antibody to samples: Add 1 uL of the antibody specific for the HA tag and conjugated to a 488 fluorophore to both tubes.<br />
#Incubate samples on nutator at room temperature for 1 hour.<br />
#*During this incubation time, complete Part 3 of the protocol.<br />
#After incubation, pellet cells at 4000xg for 2 minutes. Discard supernatant carefully with vacuum aspirator or with pipette (Do not touch or disturb the yeast pellet!). Wash with an additional 1 mL of PBSA, pellet, remove supernatant, and resuspend with 1 mL of PBSA. <br />
#Place samples on ice until analysis. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Calculate the volumes of yeast required to measure 1x10<sup>6</sup> cells<br />
<br />
===Part 3: Perform metal uptake experiment===<br />
#Obtain &#x394;Met17 transformed with pYAGA_peptide culture from the front bench<br />
#While you prepare the experiment with your mutant, the instructors will prepare controls using the following cultures:<br />
#*Untransformed &#x394;Met17<br />
#*&#x394;Met17 transformed with control peptide<br />
#Gently tritruate with a 1ml pipette to create a homogeneous suspension for each culture<br />
#Obtain cuvettes from the front bench to measure the OD<sub>600</sub> of each culture prior to beginning the experiment<br />
#Add 1ml of each cell suspension to individual cuvettes and read on the spectrophotometer<br />
#*Use 1ml SD-G for a blank.<br />
#Record these numbers in your notebook<br />
#Using SD-G media as a diluent, dilute each of your cultures to OD<sub>600</sub> ~ 1.0 and a final volume of 8ml. This does not have to be exact, but the cultures should have a similar OD<sub>600</sub> before you begin the experiment.<br />
#Add CdCl<sub>2</sub> and FeCl<sub>2</sub> for final concentration of 100&mu;M in each culture and add to a new glass tube.<br />
#Incubate your labeled glass tubes shaking at 30&deg;C for 2.5 hours to allow uptake.<br />
#*During this incubation time, '''complete Parts 3 of the wiki'''.<br />
#Following incubation, take an additional OD<sub>600</sub> reading to account for any changes in culture density, and allow normalization of data across groups.<br />
#*Record this in your notebook.<br />
#Transfer your cultures to 15ml conical tubes.<br />
#Centrifuge cultures at 1000 ''xg'' for 5 minutes to pellet cells.<br />
#During centrifugation, label 2 '''metal-free 15ml conical tubes''' for your mutant culture, and prepare a 10ml syringe filter for each culture<br />
#Using serological pipette, remove 6ml media supernatent without disrupting the pellet and add it to a metal-free conical tube.<br />
#Bring your samples to the front bench and add 175ul ultra-pure nitric acid to each sample. Return to your bench with your samples.<br />
#Using a serological pipette, carefully triturate each sample to fully mix the acid.<br />
#Open your 10ml filter syringe and place it over the top of a fresh metal-free conical tube. Add the mixed sample to the open syringe and use the plunger to push the sample through the 0.22 &mu;M filter.<br />
#Close each tube with sample and place them at the front bench.<br />
#Discard materials used to filter the samples in the black bin at the front bench.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
<br />
*What volume of CdCl<sub>2</sub> will you add to obtain a final concentration of 100 &mu;M?<br />
*What volume of FeCl<sub>2</sub> will you add to obtain a final concentration of 100 &mu;M?<br />
*Why is it important to use metal-free tubes to store your samples for analysis?<br />
*Why is it important to filter your samples before submitting them for analysis?<br />
<br />
<br />
=== Part 4: Accuri Flow Cytometry of Stained Yeast Samples ===<br />
<br />
To prepare for analysis, the Accuri flow cytometer needs to be flushed with fluid to remove any contamination from previous samples. Your samples will then be filtered one by one into round bottom analyzer tubes and placed under the cytometer sample injection port (SIP). The machine will then suck up the sample, and produce the dot plots. The Accuri will record the data from each laser and filter for every cell. The gating that the instructor performs will simply help visualize the samples as we perform the experiment but all the data will be saved automatically for post-processing analysis. <br />
<br />
#Turn machine on. MilliQ water (ultra-pure water) should be in a tube on the sample injection port (SIP).<br />
#Visually check waste containers and buffers. <br />
#Open BD AccuriC6 software on the computer. <br />
#To clean the machine, place a round bottom tube with cleaning solution on the SIP and under Run settings, choose "Run with Limits" and set 5 minutes and click RUN.<br />
#Once the 5min cleaning is complete, place an empty tube on the SIP and under Run settings, click the backflush button to rinse the system. <br />
#Place a fresh tube with 2ml of MilliQ water and run for 2min. <br />
#You are now ready to analyze your samples. <br />
[[Image:Sp21 AccuriC6software.jpg|right|thumb|350px|BD Accuri C6 Software interface]]<br />
#Place one filter cap tube in a rack and take your unstained yeast sample from the ice bucket. <br />
#Invert the yeast microcentrifuge tube once, take the P1000 pipet and take up the yeast sample. Place the pipet tip flush against the filter cap and push the yeast sample through the 35um mesh into the round bottom tube. <br />
#Remove the filter cap off of the yeast sample, take the MilliQ water tube off of the SIP and place the tube with filtered yeast on the SIP. <br />
#Choose the analysis parameters in the software under Run settings. Run with limits: 10,000 events, instead of a time limit. <br />
#Choose an analysis cell in the software with no events recorded and hit the RUN button. <br />
#*Unused cells are white (Example, C1) and cells with stored data are blue (Example, A1). <br />
#*We will detail gating and fluorescent analysis on M2D5.<br />
#As the analysis proceeds, prepare your next yeast sample according to the steps above. <br />
#Data is collected in individual cells in the software. Make sure to move the event record to a new cell between samples. Hit RUN each time you start a new sample analysis. <br />
#*Either name the cells with experimental details or write in your notes which samples are analyzed in each cell. <br />
#Once all of the samples are analyzed, place a round bottom tube of Decon solution (10% bleach) on the SIP and run for 2min. <br />
#The flow cytometer is now ready for the next user. <br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*XXX<br />
<br />
==Reagents list==<br />
*Complete synthetic media - tryptophan (CSM-T) media: 0.17% yeast nitrogen base without amino acid and ammonium sulfate (BD Bacto), 0.5% ammonium sulfate (Sigma), 0.13 % amino acid mix lacking tryptophan (US Biological), 2% glucose (BD Bacto), 0.1% adenine hemisulfate (Sigma)<br />
*Complete synthetic media - tryptophan + Cysteine, Methionine, and galactose (CSM-G) media: 0.17% yeast nitrogen base without amino acid and ammonium sulfate (BD Bacto), 0.5% ammonium sulfate (Sigma), 0.13 % amino acid mix lacking tryptophan (US Biologicals), 0.005% Methionine (Sigma), 0.005% Cysteine (Sigma), 2% galactose (Sigma), 0.1% adenine hemisulfate (Sigma)<br />
*Cadmium nitrate (Sigma), stock concentration= 100mM<br />
*ULTREX II, Ultrapure Nitric acid (J.T. Baker)<br />
*Hydrophilic PTFE 0.22&mu;m filters (J.T. Baker)<br />
*Metal-Free sterile polypropylene tubes (VWR)<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D6 |Quantify cadmium removal from media]] <br><br />
Previous day: [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D320.109(S24):M2D32024-03-12T20:41:46Z<p>Becky Meyer: /* Reagents list */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
==Introduction==<br />
<br />
In the previous laboratory session, you performed the procedure used to generate the hexapeptide display plasmids. Today, we will confirm that the cloning worked and transform the plasmids into our &#x394;Met17 yeast to test the functionality of the peptides. We are able to move our peptide display plasmid between organisms because we are using a "shuttle vector" to express the DNA. The shuttle vector has features that allow it to be selectively expressed in both bacteria and yeast.<br />
<br />
In order to confirm cloning and create purified plasmid for yeast transformation, we need to isolate hexapeptide plasmids from the E. coli system used to amplify a single plasmid clone generated during the last class. To purify the plasmid, we will perform a mini-prep. This plasmid preparation protocol uses alkaline lysis to separate the plasmid DNA from the chromosomal DNA and cellular debris, allowing the plasmid DNA to be studied further. The key difference between plasmid DNA and chromosomal DNA is size and this difference is what is used to separate the two components.<br />
[[Image:Qiagen_alkalinelysis.jpg|thumb|right|450px|'''Schematic of alkaline lysis: Blue DNA genomic and red DNA plasmid. Image by Qiagen''']] <br />
In this protocol the media is removed from the cells by centrifugation. The cells are first resuspended in a solution that contains Tris, to buffer the cells, and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. Second, an alkaline lysis buffer containing sodium hydroxide and the detergent sodium dodecyl sulfate (SDS) is added. The base denatures the cell’s DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. Third. the pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. The DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The smaller plasmid DNA renatures normally and stays in solution, effectively separating plasmid DNA from the chromosomal DNA and the proteins and lipids of the cell. At this point the solution is spun at a high speed and soluble fraction, including the plasmid, is kept for further purification and the insoluble fraction, the macromolecules and chromosomal DNA is pelleted and thrown away. Following these steps there are several more washes to purify the plasmid DNA but the major purification work, separating the plasmid from the chromosomal DNA and cell lysate, is completed by the three steps shown in the figure.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Mini-prep peptide clones===<br />
<br />
The procedure for DNA isolation using small volumes is commonly termed "mini-prep," which distinguishes it from a “maxi-prep” that involves a larger volume of cells and additional steps of purification. The overall goal of each prep is the same -- to separate the plasmid DNA from the chromosomal DNA and cellular debris. In the traditional mini-prep protocol, the media is removed from the cells by centrifugation. The cells are resuspended in a solution that contains Tris to buffer the cells and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. A solution of sodium hydroxide and sodium dodecyl sulfate (SDS) is then added. The base denatures the DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. The pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. In addition, the DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The plasmid DNA renatures normally and stays in solution. Thus plasmid DNA got effectively separated from chromosomal DNA and proteins and lipids of the cell. <br />
<br />
Today you will use a kit that relies on a column to collect the renatured plasmid DNA. The silica gel column interacts with the DNA while allowing contaminants to pass through the column. This interaction is aided by chaotropic salts and ethanol, which are added in the buffers. The ethanol dehydrates the DNA backbone allowing the chaotropic salts to form a salt bridge between the silica and the DNA.<br />
<br />
For timing reasons, two colonies from the spread plates you prepared in the previous laboratory session were inoculated into LB/Amp and grown overnight at 37&deg;C on a rotator.<br />
<br />
#Retrieve your two cultures from the font laboratory bench. Label two eppendorf tubes to reflect your samples (Clone#1 and Clone#2). <br />
#Vortex the bacterial cultures and pour ~1.5 mL of each into the appropriate eppendorf tube. [[Image:Removing cells.jpg|thumb|right|200px|'''Diagram showing how to aspirate the supernatant.''' Be careful to remove as few cells as possible.]] <br />
#Balance the tubes in the microfuge, spin them at maximum speed for 2 min, and remove the supernatants with the vacuum aspirator.<br />
#Pour another 1.5 mL of each culture into the appropriate eppendorf tube (add the culture to the pellet previously collected), and repeat the spin step. Repeat until you use up the entire volume of culture.<br />
#Resuspend each cell pellet in 250 &mu;L buffer P1. <br />
#*Buffer P1 contains RNase so that we collect only our nucleic acid of interest, DNA.<br />
#Add 250 &mu;L of buffer P2 to each tube, and mix by inversion until the suspension is homogeneous. About 4-6 inversions of the tube should suffice. You may incubate here for '''up to 5 minutes, but not more'''.<br />
#*Buffer P2 contains sodium hydroxide for lysing. <br />
#Add 350 &mu;L buffer N3 to each tube, and mix '''immediately''' by inversion (4-10 times).<br />
#*Buffer N3 contains acetic acid, which will cause the chromosomal DNA to messily precipitate; the faster you invert, the more homogeneous the precipitation will be.<br />
#*Buffer N3 also contains a chaotropic salt in preparation for the silica column purification.<br />
#Centrifuge for 10 minutes at maximum speed. Note that you will be saving the '''supernatant''' after this step.<br />
#*Meanwhile, prepare 2 labeled QIAprep columns, one for each candidate clone, and 2 trimmed eppendorf tubes for the final elution step.<br />
#Transfer the entire supernatant to the column and centrifuge for 1 min. Discard the eluant into a tube labeled ''''Qiagen waste'.'''<br />
#Add 0.5 mL PB to each column, then spin for 1 min and discard the eluant into the Qiagen waste tube. <br />
#Next wash with 0.75 mL PE, with a 1 min spin step as usual. Discard the ethanol in the Qiagen waste tube.<br />
#After removing the PE, spin the mostly dry column for 1 more minute. <br />
#*It is important to remove all traces of ethanol, as they may interfere with subsequent work with the DNA.<br />
#Transfer each column insert (blue) to the trimmed eppendorf tube you prepared (cut off lid).<br />
#Add 30 &mu;L of distilled H<sub>2</sub>O pH ~8 to the top center of the column, wait 1 min, and then spin 1 min to collect your DNA.<br />
#Cap the trimmed tube or transfer elution to new eppendorf tube.<br />
#Alert the Instructor when you are ready to measure the concentration of DNA in your mini-prep.<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Record the concentration for each of the mini-prep you prepared.<br />
*Record the 260/280 ratio for of the mini-preps you prepared. What does this value indicate about the purity of the DNA in your mini-preps?<br />
<br />
===Part 2: Transform peptide display plasmid into &#x394;Met17 yeast cells===<br />
<br />
Following DNA production by competent bacteria, the next step is moving the plasmid to our yeast model system for experimentation. To do this, we create competent &#x394;Met17 cells and use a proprietary chemical transformation procedure to insert our newly created mutations. Yeast that have successfully been transformed are selected by utilizing plates that are made with synthetic dropout media, allowing only yeast expressing our plasmid to survive.<br />
<br />
During transformation, a plasmid enters a competent yeast, then replicates and expresses the encoded genes. Following the transformation procedure, a mixed population of cells exists as shown in the figure to the right: some cells did not uptake the plasmid (light blue cells) while others contain the plasmid that carries the cassette allowing for tryptophan production (dark blue cells), Because the agar plate used for selection does not contain a tyrptophan supplement, only bacterial cells that harbor the plasmid survive and reproduce to form a colony.<br />
<br />
[[Image:Yeast transformation image.jpg|thumb|right|550px|'''Schematic of yeast transformation.''' Yeast cells that harbor the plasmid (dark blue cells) are selected for using an agar plate that lacks tryptophan. Image generated using Biorender]]In the yeast plasmid system, a gene on the pYAGA expression vector encodes an ODCase cassette which catalyzes de novo synthesis of tryptophan. Thus, only transformed yeast will grow on agar plates lacking tryptophan.<br />
<br />
Most yeast do not usually exist in a “transformation ready” state, referred to as competence. Instead yeast cells are incubated with LiAc to promote competency by making the cells permeable to plasmid DNA uptake. Competent cells are extremely fragile and should be handled gently, specifically the cells should be kept cold and not vortexed. The transformation procedure is efficient enough for most lab purposes, but much lower than bacterial transformation efficiency. Bacterial efficiencies can be as high as 10<sup>9</sup> transformed cells per microgram of DNA, while yeast transformation using lithium cations tends to peak at 10<sup>6</sup> transformed cells per microgram of DNA. <br />
<br />
You will transform each of your mini-prepped plasmids into &#x394;Met17 yeast, which is the strain we will use to examine the effect of your approach on cadmium uptake. <br />
<br />
#Label two 1.5 mL eppendorf tubes with your team information and clone designation (Clone#1 and Clone#2).<br />
#Acquire an aliquot of the competent &#x394;Met17 yeast (prepared by the teaching faculty) from the front laboratory bench.<br />
#Pipet 50 &mu;L of the &#x394;Met17 competent cells into each labeled eppendorf tube.<br />
#*'''Remember:''' it is important to keep the competent cells on ice! Also, avoid over pipetting and vortexing!<br />
#Add 5 &mu;L of each clone candidate clone mini-prep to the appropriate eppendorf tube.<br />
#Add 500 &mu;L Solution 3 and mix gently by flicking the tube.<br />
#Incubate your transformation mixes at 30 &deg;C for 45 min, gently mixing 2-3 times throughout the incubation.<br />
#Once you have begun the incubation, retrieve and label one SD-U plate for each transformant. Be sure to include transformant number, your team/section, and the date on each plate.<br />
#Retrieve your transformations from the incubator and alert the teaching faculty that you are ready to plate your samples.<br />
#Plate 150&mu;L of each co-transformation onto an appropriately labeled SD-U agar plate.<br />
#*The teaching faculty will demonstrate how you should 'spread' your co-transformation onto the SD-U agar plates. You should include this procedure in your laboratory notebook.<br />
#Incubate your spread plates in the 30 &deg;C incubator for 2-4 days.<br />
<br />
===Part 3: Prepare plasmid clones for sequencing analysis===<br />
<br />
DNA sequencing will be used to confirm that the cloning is correct. The invention of automated sequencing machines has made sequence determination a relatively fast and inexpensive process. The method for sequencing DNA is not new but automation of the process is recent, developed in conjunction with the massive genome sequencing efforts of the 1990s and 2000s. At the heart of sequencing reactions is chemistry worked out by Fred Sanger in the 1970s which uses dideoxynucleotides, or chain-terminating bases. These chain-terminating bases can be added to a growing chain of DNA but cannot be further extended. Performing four reactions, each with a different chain-terminating base, generates fragments of different lengths ending at G, A, T, or C. The fragments, once separated by size, reflect the DNA sequence due to the presence of fluorescent dyes, one color linked to each dideoxy-base. The four colored fragments can be passed through capillaries to a computer that can read the output and trace the color intensities detected. <br />
<br />
[[Image:Fa20 M3D2 sanger sequencing.png|thumb|center|700px|'''Principles of Sanger sequencing.''' A. Chain-terminating bases are used to halt the DNA synthesis reaction at different lengths and attach a fluorophore that is used to determine the sequence of the DNA strand. B. The sequence of the DNA strand is determined using the fluorescent signature associated with each length of DNA in the reaction, this is visualized as a chromatogram.]]<br />
<br />
Just as amplification reactions require a primer for initiation, primers are also needed for sequencing reactions. Legible readout of the gene typically begins about 40-50 bp downstream of the primer site, and continues for ~1000 bp at most. Thus, multiple primers must be used to fully view genes > 1 kb in size. Though the target sequence for your point mutation is shorter than 1000 bp, we will sequence with both a forward and reverse primer to double-check that the sequence is correct (''i.e.'' free of unwanted mutations). Often vectors will include common features like types of promoters. Companies offering sanger sequencing services will often call these "universal primers" since they are frequently used. We will use two of these universal primers to sequence your clones.<br />
<br />
The sequences for the primers you will use to confirm your peptide insert are below:<br />
<br />
<br />
<center><br />
{| border="1"<br />
! Primer<br />
! Sequence<br />
|-<br />
| M13R_Fwd<br />
| 5' - CAGGAAACAGCTATGAC - 3'<br />
|-<br />
| M13F_Fwd<br />
| 5' - GTAAAACGACGGCCAG - 3'<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
Because you will examine the peptide insert sequence in your using both a forward and a reverse primer, '''you will need to prepare two reactions for each mini-prep'''. Thus you will have a total of four sequencing reactions. For each reaction, combine the following reagents in a clearly labeled eppendorf tube:<br />
*12 &mu;L nuclease-free water<br />
*8 &mu;L of your plasmid DNA candidate<br />
*10 &mu;L of the primer stock from the front laboratory bench (the stock concentration is 5 pmol/&mu;L)<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Calculate the quantity (in ng) of DNA in each of the sequencing reactions. <br />
*Calculate the final concentration of sequencing primer in each reaction.<br />
<br />
==Reagents list==<br />
*QIAprep Spin Miniprep Kit (from Qiagen)<br />
**buffer P1<br />
**buffer P2<br />
**buffer N3<br />
**buffer PB<br />
**buffer PE<br />
*Frozen-EZ Yeast Transformation II Kit (from Zymo Research)<br />
**Solution 3<br />
*Chemically competent &#x394;Met17 yeast (genotype: ''MATa/MATα {leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15} [phi+] &#x394;met17''))<br />
*CSM-TRP plates<br />
**Complete synthetic media - tryptophan (CSM-T) media: 0.17% yeast nitrogen base without amino acid and ammonium sulfate (BD Bacto), 0.5% ammonium sulfate (Sigma), 0.13 % amino acid mix lacking tryptophan (US Biological), 2% glucose (BD Bacto), 0.1% adenine hemisulfate (Sigma)<br />
**Plates prepared by adding 2% agar (BD Bacto) to SD media<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br><br />
Previous day: [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Module_220.109(S24):Module 22024-03-12T19:45:39Z<p>Becky Meyer: /* References */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
<br />
==Module 2: protein engineering==<br />
Heavy metal environmental contamination is an increasing concern. Heavy metals are released into the environment during activities like mining and fertilizer release in farming. Additionally, heavy metals are released into the environment from the disposal of electronic waste. As such, the ability to remove the metal contamination from soil and water is a topic of great interest.<br />
<br />
One way to approach this problem is by harnessing known biological mechanisms and repurpose them to clean environmental pollution. This is known as bioremediation. In this module, we will use protein engineering to attempt to create a model system for bioremediation by taking advantage of a genetically tractable model organism ''Saccharomyces cerevisiae'' (baker's yeast). We will be utilizing a version of this organism that has been genetically modified to produce hydrogen sulfate, which will precipitate cadmium in the media.<br />
<br />
Our aim in Mod 2 is to use this strain of hydrogen sulfide producing yeast and engineer a cell surface display system to display a peptide of your design in order to capture precipitating cadmium. We will then assess the quantity of cadmium captured as well as it's quality for recycling back into the manufacturing process.<br />
<br />
<br />
<font color= #015526 >'''Research goal: Genetically engineer a cell surface display peptide to capture cadmium in a model of bioremediation '''</font color><br />
<br />
<br />
<br />
[[Image:Sp24 Mod2 overview.png|center|750px|thumb|Image generated using BioRender.]]<br />
<br />
<br />
<br style="clear:both;"/><br />
<br />
==Lab links: day by day==<br />
M2D1: [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> <br />
M2D2: [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> <br />
M2D3: [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> <br />
M2D4: [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <br />
M2D5: [[20.109(S24):M2D5 |Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
M2D6: [[20.109(S24):M2D6 |Quantify cadmium removal from media]] <br><br />
M2D7: [[20.109(S24):M2D7 |Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br><br />
M2D8: [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br><br />
<br />
==Major assignments==<br />
[[20.109(S24):Journal article presentation| Journal article presentation]] <br><br />
[[20.109(S24):Research article|Research article]] <br><br />
<br />
==References==<br />
<br />
*[[Media:Sun Belcher 2019.pdf | Designing yeast as plant-like hyperaccumulators for heavy metals]]<br />
*[[Media:Sp20 M3 reference ChaoNat.pdf |Isolating and engineering human antibodies using yeast surface display.]]<br />
*[[Media:Sun Belcher 2020 yeast waste water.pdf |Using yeast to sustainably remediate and extract heavy metals from waste waters]]<br />
*[[Media:BoderE WittrupKD.pdf |Yeast surface display for screening combinatorial polypeptide libraries]]<br />
*[[Media:Hou 2020 Bioremediation review.pdf |Metal contamination and bioremediation of agricultural soils for food safety and sustainability]]<br />
<br />
==Notes for Instructors==<br />
[[20.109(S24): Prep notes for M2| Prep notes for M2]]</div>Becky Meyerhttp://measurebiology.org/wiki/File:Hou_2020_Bioremediation_review.pdfFile:Hou 2020 Bioremediation review.pdf2024-03-12T19:45:24Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D220.109(S24):M2D22024-03-12T19:06:58Z<p>Becky Meyer: /* Part 2: Prepare YSD peptide oligos */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Eurogentec oligo synthesis.png|right|400px|thumb|'''Oligo synthesis''' Image courtesy of Eurogentec]]In the previous laboratory session you chose the strategy you wanted to use to capture cadmium with a cell surface peptide, and generated primers to insert the DNA sequence for your peptide into the YSD vector. Today you will perform the mutagenesis procedure necessary to insert the peptide DNA sequence into our expression vector. To accomplish this insertion, we will use the Q5 Site-Directed Mutagenesis (SDM) kit from NEB. While there are multiple approaches to DNA mutagenesis, this kit offers the advantage of reliable generation of mutants while still being relatively cost effective. This SDM kit utilizes PCR with the specialized primers you designed to introduce the insertion and amplify the resulting plasmid.<br />
<br />
Before we continue, we should review the process used to generate actual primers that are used to amplify DNA as part of this process. Current oligonucleotide, or primer, synthesis uses phosphoramidite monomers, which are simply nucleotides with protection groups added. The protection groups prevent side reactions and promote the formation of the correct DNA product. The DNA product synthesis starts with the 3'-most nucleotide and cycles through four steps: deprotection, coupling, capping, and stabilization. First, deprotection removes the protection groups. Second, during coupling the 5' to 3' linkage is generated with the incoming nucleotide. Next, a capping reaction is completed to prevent uncoupled nucleotides from forming unwanted byproducts. Lastly, stabilization is achieved through an oxidation reaction that makes the phosphate group pentavalent. For a more detailed description of this process, read [[Media:IDT chemical-synthesis-of-oligonucleotides.pdf |this article]] from IDT DNA.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Research pCTCON2 expression vector===<br />
[[Image:Sp24 pCTCON2.png |right|thumb|500px| Vector map generated in Snapgene]]<br />
<br />
In order to study the effects of cell surface display of your peptide of interest in yeast, a plasmid vector must be used to introduce your peptide into the yeast model system. The vector backbone includes several key features that enable successful expression of the peptides. To understand our model system, first familiarize yourself with the important features of the expression plasmid. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
<br />
In this exercise, you will explore the features present in the plasmid that are necessary to express the peptide sequence (see plasmid map below).<br />
<br />
*Describe the purpose / role for each of the following features that are present in the pCTCON2 plasmid backbone. Please note: you many need to reference resources outside of the wiki!<br />
**T3 promoter<br />
**Aga2<br />
**HA and myc epitopes<br />
**AmpR<br />
**TRP1<br />
*Our expression vector is known as a "shuttle vector". What is this term, and what features of our vector enable this performance?<br />
*Your peptide will be inserted between two features on this map. Which ones? Why?<br />
<br />
===Part 2: Prepare YSD peptide oligos===<br />
The instructors took DNA sequence you selected for your display peptide and added flanking DNA sequences to the oligos so that we could orient the peptide with our detection tags. <br />
<br />
The Forward primer sequence added was "5 - GGCGGATCCGAACAAAAG - 3" at the end of your sequence so that your final display peptide will include 3 flanking amino acids at the C terminus (Gly-Gly-Ser) which provide a spacer between your peptide and the C-terminal myc tag.<br />
<br />
The Reverse primer sequence added was "5 - AGCCTGCAGAGCGTAG - 3" at the beginning of your sequence so that your final display peptide in include 3 flanking amino acids at the N terminus (Leu-Gln-Ala)which provide a spacer between your peptide and the N-terminal HA tag.<br />
<br />
Adding these additional bases to create your primer allows the primers to become the right length to anneal correctly to the vector and also results in spacers between your peptide and the tags.<br />
<br />
While you were away the sequences for the insertion primers you designed were submitted to Genewiz. Genewiz synthesized the DNA oligos then lyophilized (dried) it to a powder. Follow the steps below to resuspend your oligo (or 'primer').<br />
#Centrifuge the tubes containing your lyophilized oligos for 1 min.<br />
#Calculate the amount of water needed to give a stock concentration of 100 &mu;M for each oligo. <br />
#Resuspend each primer stock in the appropriate volume of sterile water, vortex, and centrifuge.<br />
#Calculate the volume of your stock that is required to prepare a 20 &mu;L of solution that contains your mutagenesis oligo at a concentration of 10 &mu;M.<br />
#*Try the calculation on your own first. If you get stuck, ask the teaching faculty for help.<br />
#Prepare a primer mix that contains both your forward and reverse oligos at a final concentration of 10 &mu;M in 20 &mu;L of sterile water.<br />
#*Be sure to change tips between primers!<br />
#Return the rest of your peptide insertion oligo stocks, plus your primer specification sheet, to the front bench.<br />
<br />
===Part 3: Use site directed mutagenesis to introduce your peptide sequence into pCTCON2===<br />
<br />
To perform site-directed mutagenesis (SDM), custom designed oligonucleotides, or primers, are used to incorporate mutations into double-stranded DNA plasmid as a specific location. These mutations can change the bases of the sequence, delete bases, or insert bases. One approach to SDM is to use primers that align to the sequence in the plasmid in a back-to-back orientation. As shown in top left of the schematic below, the primers (forward primer = black arrow and reverse primer = red arrow) anneal to the plasmid such that the 5' ends of the primers anneal to the DNA in a back-to-back orientation. In Step #1 of the schematic, the forward primer is used to replicate the top strand (outside circle of the plasmid) and the reverse primer is used to replicate the bottom strand (inside circle of the plasmid). The resulting single-stranded products (extension from each primer generates a single-stranded product) are able to anneal due to sequence homology, as shown in the first quadrant of the zoom-in for Step #2. In Step #2A the 5' ends of the linear, single-stranded amplification products are phosphorylated to prepare for ligation (Step #2B). Remember that a 5' phosphate is required for 3' OH nucleophilic attack, this results in circular plasmids. <br />
<br />
Thus far in this description of SDM, one very important detail has not been mentioned. How specifically is the insertion coded in the primers incorporated into the plasmid sequence? In the top left of the schematic, the forward primer contains a "squiggle" mark that represents the desired insertion. The single-stranded product that results from extension from this primer will contain the desired insertion and therefore be incorporated into the products generated in Step #1. Lastly, in Step #2C the plasmid template that contains the unmutated parental sequence is destroyed so that only the plasmids with the desired insertion are present at the end of the procedure.<br />
<br />
[[Image:Sp24 Q5 insertion.png|thumb|center|650px|'''Schematic of NEB Q5 Site Directed Mutagenesis procedure.''' Image modified from Q5 Site-Directed Mutagenesis Kit Manual published by NEB.]]<br />
<br />
<br />
For this procedure we are using the Q5 Site Directed Mutagenesis Kit from NEB. A more technical depiction of the protocol you will use to introduce a peptide sequence insertion is included below. Briefly, in Step 1 DNA polymerase copies the plasmid using the forward primer to insert the new DNA sequence. Following PCR amplification the product is a linear DNA fragment. In Step 2 circular plasmids that carry the point mutation are generated when the double-stranded DNA is phosphorylated (Step 2A) and then ligated (Step 2B). Following the amplification reaction, the expression plasmid template that does not contain insert is present in the reaction product. To ensure that only the insertion-containing expression plasmid is used in the next steps, the parental DNA is selectively digested using the DpnI enzyme (Step 2C). The underlying selective property is that DpnI only digests methylated DNA. Because DNA is methylated during replication in host cells, DNA that is synthetically made via an amplification reaction using PCR is not methylated. Lastly, in Step 3 the insert-containing expression plasmid is transformed into competent cells that propagate the plasmid. <br />
<br />
Each group will set up one reaction. You should work quickly but carefully, and keep your tube in a chilled container at all times. '''Please return shared reagents to the ice bucket(s) from which you took them as soon as you are done with each one.'''<br />
#Retrieve one PCR tube from the front laboratory bench and label the top with your team color and lab section (write small!). <br />
#Add 10.25 &mu;L of nuclease-free water.<br />
#Add 1.25 μL of your primer mix (each primer should be at a concentration of 10 &mu;M).<br />
#Add 1 &mu;L of CTCON2 plasmid DNA (concentration of 25 ng/&mu;L).<br />
#Lastly, use a filter tip to add 12.5 &mu;L of Q5 Hot Start High-Fidelity 2X Master Mix - containing buffer, dNTPs, and polymerase - to your tube.<br />
#Once all groups are ready, we will begin the thermocycler, under the following conditions: <br />
<br />
<center><br />
{| border="1"<br />
! Segment<br />
! Cycles<br />
! Temperature<br />
! Time <br />
|-<br />
| Initial denaturation<br />
| 1<br />
| 98 &deg;C<br />
| 30 s<br />
|-<br />
| Amplification<br />
| 25<br />
| 98 &deg;C<br />
| 10 s<br />
|-<br />
| <br />
|<br />
| 63 &deg;C<br />
| 30 s<br />
|-<br />
|<br />
|<br />
| 72 &deg;C<br />
| 3 min<br />
|-<br />
| Final extension<br />
| 1<br />
| 72 &deg;C<br />
| 2 min<br />
|-<br />
| Hold<br />
| 1<br />
| 4 &deg;C<br />
| indefinite<br />
|}<br />
</center><br />
<br />
After the cycling is completed, you will complete the KLD reaction (which stands for "kinase, ligase, ''Dpn''I").<br />
#Add the following reagents:<br />
#*1 &mu;L of your amplification product<br />
#*5 &mu;L 2X KLD Reaction Buffer<br />
#*1 &mu;L KLD Enzyme Mix<br />
#*3 &mu;L nuclease-free water <br />
#Incubate the reaction for 5 min at room temperature.<br />
#Then, use 5 &mu;L of the KLD reaction product to complete a transformation into an ''E. coli'' strain (NEB 5&alpha; cells of genotype ''fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17'').<br />
#*The transformed cells will amplify the plasmid such that you are able to confirm the appropriate mutation was incorporated. <br />
#Transform the cells using the following procedure:<br />
#*Add 5 &mu;L of KLD mix to 50 &mu;L of chemically-competent NEB 5&alpha;.<br />
#*Incubate on ice for 30 min.<br />
#*Heat shock at 42 &deg;C for 30 s.<br />
#*Incubate on ice for 5 min.<br />
#*Add 950 &mu;L SOC and gently shake at 37 &deg;C for 30 min.<br />
#*Spread 150 &mu;L onto LB+Amp plate and incubate overnight at 37 &deg;C.<br />
<br />
==Reagents list==<br />
*pCTCON2 vector (a gift from the Wittrup lab)<br />
*Q5 Site Directed Mutagenesis Kit (from NEB)<br />
**Q5 Hot Start High-Fidelity 2X Master Mix: propriety mix of Q5 Hot Start High-Fidelity DNA Polymerase, buffer, dNTPs, and Mg<sup>2+</sup><br />
**2X KLD Reaction Buffer<br />
**10X KLD Enzyme Mix: proprietary mix of kinase, ligase, and ''DpnI'' enzymes<br />
*SOC medium: 2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose<br />
*LB+Amp plates<br />
**Luria-Bertani (LB) broth: 1% tryptone, 0.5% yeast extract, and 1% NaCl<br />
**Plates prepared by adding 1.5% agar and 100 μg/mL ampicillin (Amp) to LB<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br><br />
Previous day: [[20.109(S24):M2D1 |Determine peptide design strategy]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Spring_2024_schedule20.109(S24):Spring 2024 schedule2024-03-12T14:12:00Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
Welcome to 20.109! It is our goal to make this class a useful and fun introduction to the experiments and techniques used in biological engineering. Though there is not enough time to show you everything needed to do research, after this class you will feel confident and familiar with some fundamental experimental approaches and laboratory protocols. You will develop good habits at the bench, which will increase the likelihood of success in your work and ensure the health and safety of you and your labmates. By the end of the semester, you will also be well-versed in good scientific practices - through your experience with scientific writing, notebook keeping, and orally presenting data and novel ideas. All of us involved in teaching 20.109 hope you will find it a satisfying challenge and an exciting experience that has lasting value.<br />
<br />
<font color= #2f9b91 >'''SCHEDULE DETAILS:'''</font color><br><br />
<font color= #3bc2b6 >'''Lecture times:'''</font color> Tuesday (T) and Thursday (R) 11 - 12 pm in 4-237<br><br />
<font color= #3bc2b6 >'''Laboratory section times:'''</font color> Tuesday (T) and Thursday (R) 1 - 5 pm or Wednesday (W) and Friday (F) 1 - 5 pm in 56-322<br><br />
<br />
<font color= #2f9b91 >'''ABSENCE POLICY:'''</font color><br><br />
<font color= #3bc2b6 >'''Absences from lecture:'''</font color> Attendance will be recorded for participation points throughout the semester. If absent, student is responsible for all information provided in lecture. <br><br />
<font color= #3bc2b6 >'''Absences from laboratory:'''</font color> Excused absences should be discussed with the Instructors as soon as possible. Because make-up laboratory time is not provided, attendance in another section may be required to complete the necessary experiments. Unexcused absences will result in a 1/3 of a letter grade deduction from the final grade on the major assignment for the module (for example, a B+ would become a B).<br />
<br />
{| border=1px<br />
|'''MODULE'''<br />
|'''DATE'''<br />
|'''LECTURER'''<br />
|'''LABORATORY EXPERIMENTS'''<br />
|'''ASSIGNMENTS'''<br />
|--<br />
| <br />
| T/W Feb 6/7 <br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [[Media:Sp24 Orientation lecture student.pdf| Lecture slides]]<br />
| [[20.109(S24):Laboratory tour | Orientation and laboratory tour]]<br> [[Media:Sp24 EHS slides.pdf | EHS slides]]<br>[[Media:Sp24 M0 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M0_jz.pdf| WF prelab slides]]<br />
|<br />
|--<br />
| M1D1<br />
| R/F Feb 8/9<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L1 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D1 | Complete in-silico cloning of protein expression vector]]<br> [[Media:Sp24 M1D1 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D1 jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Orientation quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D1|Homework due]]<br />
|--<br />
| M1D2<br />
| T/W Feb 13/14 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> <br />
| [[20.109(S24):M1D2 |Purify expressed protein]] <br> [[Media:Sp24 M1D2 nll.pdf| TR prelab slides]] & [https://www.dropbox.com/scl/fi/qq54ep8nhjhwk5xy80x5l/Protein-Purification-Demo.mp4?rlkey=h00htz57i5tt2y9hz8qpieily&dl=0| Protein purification video] <br>[[Media:Sp24 M1D2 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D2|Homework due]]<br />
|--<br />
| M1D3<br />
| R/F Feb 15/16 <br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L2 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D3 |Assess purity and concentration of expressed protein]] <br> [[Media:Sp24 M1D3 nll.pdf| TR prelab slides]] <br> [[Media:Sp24 M1D3 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D3|Homework due]]<br />
|--<br />
| <br />
| T/W Feb 20/21<br />
| <br />
| <font color = #e1452f>'''President's Day holiday'''</font color><br />
| <br />
|--<br />
| M1D4<br />
| R/F Feb 22/23<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L3 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D4 |Review results of small molecule microarray (SMM) screen]] <br> [[Media:Sp24 M1D4 nll.pdf| TR prelab slides]] <br> [[Media:Sp24_M1D4_jz.pdf| WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D4|Homework due]]<br />
|--<br />
| M1D5<br />
| T/W Feb 27/28<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L4 2024.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D5 |Setup differential scanning flourimetry (DSF) experiment]] <br> [[Media:Sp24 M1D5v2 nll.pdf| TR prelab slides]]<br>[[Media:Sp24_M1D5_jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D5|Homework due]] <br> <br />
|--<br />
| M1D6<br />
| R/F Feb/Mar 29/1<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L6 2024 short.pdf| Lecture slides]]<br />
| [[20.109(S24):M1D6 |Prepare cells for electromobility shift assay (EMSA)]] <br> [[Media:Sp24 M1D6 nll.pdf|TR prelab slides]] <br> [[Media:Sp24 M1D6 jz.pdf|WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D6|Homework due]] <br> [[20.109(S24):Research talk| <font color = #2f9b91>'''Research talk due'''</font color>]] Mon, Mar 4 at 10pm <br><br />
|--<br />
| M1D7<br />
| T/W Mar 5/6<br />
| [http://be.mit.edu/directory/angela-koehler AK] <br> [[Media:20109 M1L7 2024 .pptx| Lecture slides]]<br />
| [[20.109(S24):M1D7 |Complete EMSA experiment]] <br> [[Media:Sp24 M1D7 nll.pdf| TR prelab slides]]<br> [[Media:Sp24 M1D7 jz.pdf| WF prelab slides]]<br />
| [[20.109(S24):Homework#Due_M1D7|Homework due]] <br />
|--<br />
| M1D8<br />
| R/F Mar 7/8<br />
| BE Comm Lab <br> <br />
| [[20.109(S24):M1D8 |Evaluate experimental results]] <br> [[Media:Sp24 M1D8v2 nll.pdf| TR & WF prelab slides]]<br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M1D8|Homework due]] <br />
|--<br />
| M2D1<br />
| T/W Mar 12/13<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> [[Media:Sp24 M2L1.pdf| Lecture slides]]<br />
| [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> <br />
| [[20.109(S24):Homework#Due_M2D1|Homework due]] <br />
|--<br />
| M2D2<br />
| R/F Mar 14/15<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> <br />
| [[20.109(S24):Homework#Due_M2D2|Homework due]] <br> [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary draft due'''</font color>]] Sat, Mar 16 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Mon, Mar 18 at 10 pm<br />
|--<br />
| M2D3<br />
| T/W Mar 19/20<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> <br />
| [[20.109(S24):Homework#Due_M2D3|Homework due]] <br> <br />
|--<br />
| M2D4<br />
| R/F Mar 21/22 <br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D4|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Mar 26/27 - R/F Mar 28/29 </font color><br />
| <br />
| <font color = #e1452f>'''Spring Break'''</font color><br />
| [[20.109(S24):Data Summary| <font color = #2f9b91>'''Data Summary revision due'''</font color>]] Mon, Mar 25 at 10 pm <br> <br />
|--<br />
|<br />
| T/W Apr 2/3<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
|<br />
|--<br />
| <br />
| R/F Apr 4/5<br />
| <br />
| [[20.109(S24):Journal article presentation| <font color = #2f9b91>'''Journal article presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, Apr 6 at 10 pm<br />
|--<br />
| M2D5<br />
| T/W Apr 9/10<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D5 | Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| M2D6<br />
| R/F Apr 11/12<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M2D6 | Quantify cadmium removal from media]] <br> <br />
| [[20.109(S24):Homework#Due_M2D5|Homework due]] <br />
|--<br />
| <br />
| <font color = 999999>T/W Apr 16/17 </font color><br />
| <br />
| <font color = #e1452f>'''Patriots' Day holiday'''</font color><br />
| <br />
|--<br />
| M2D7<br />
| R/F Apr 18/19<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br> <br />
| [[20.109(S24):M2D7 | Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br> <br />
| [[20.109(S24):Homework#Due_M2D7|Homework due]]<br />
|--<br />
| M2D8<br />
| T/W Apr 23/24<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br> <br />
| <font color= #3bc2b6 >'''Laboratory quiz'''</font color> <br> [[20.109(S24):Homework#Due_M2D8|Homework due]]<br />
|--<br />
| M3D1<br />
| R/F Apr 25/26<br />
| [http://be.mit.edu/directory/angela-belcher AB] <br> <br />
| [[20.109(S24):M3D1 |Brainstorm ideas for Research proposal presentation]] <br> <br />
| [[20.109(S24):Homework#Due_M3D1|Homework due]] <br><br />
|--<br />
| M3D2<br />
| T/W Apr/May 30/1<br />
| BE Comm Lab<br />
| [[20.109(S24):M3D2 |Pitch research proposal presentation ideas ]] <br> <br />
| [[20.109(S24):Research article| <font color = #2f9b91>'''Research article due'''</font color>]] Mon, Apr 29 at 10 pm <br> [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Tue, Apr 30 at 10 pm<br />
|--<br />
| M3D3<br />
| R/F May 2/3<br />
| [http://be.mit.edu/directory/noreen-lyell NLL] <br> [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D3 |Develop ideas for Research proposal presentation ]] <br> <br />
| [[20.109(S24):Homework#Due_M3D3|Homework due]]<br><br />
|--<br />
| M3D4<br />
| T/W May 7/8<br />
| [http://be.mit.edu/directory/becky-meyer BCM] <br><br />
| [[20.109(S24):M3D4 |Participate in Research proposal peer reviews]] <br> <br />
| [[20.109(S24):Homework#Due_M3D4|Homework due]]<br />
|--<br />
| <br />
| R/F May 9/10<br />
| <br />
| [[20.109(S24):Research proposal presentation| <font color = #2f9b91>'''Research proposal presentations'''</font color>]]<br />
| [https://mit.enterprise.slack.com/archives/C06H3BYMX8E Blog post due] Sat, May 11 at 10 pm<br />
|--<br />
| <br />
| T May 14<br />
| <font color = #e1452f>'''Celebration lunch!'''</font color> <br><br />
| <br />
| <br />
|}<br />
</div></div>Becky Meyerhttp://measurebiology.org/wiki/File:Sp24_M2L1.pdfFile:Sp24 M2L1.pdf2024-03-12T14:10:32Z<p>Becky Meyer: </p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):Module_220.109(S24):Module 22024-03-11T00:37:04Z<p>Becky Meyer: /* Module 2: protein engineering */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
<br />
<br />
==Module 2: protein engineering==<br />
Heavy metal environmental contamination is an increasing concern. Heavy metals are released into the environment during activities like mining and fertilizer release in farming. Additionally, heavy metals are released into the environment from the disposal of electronic waste. As such, the ability to remove the metal contamination from soil and water is a topic of great interest.<br />
<br />
One way to approach this problem is by harnessing known biological mechanisms and repurpose them to clean environmental pollution. This is known as bioremediation. In this module, we will use protein engineering to attempt to create a model system for bioremediation by taking advantage of a genetically tractable model organism ''Saccharomyces cerevisiae'' (baker's yeast). We will be utilizing a version of this organism that has been genetically modified to produce hydrogen sulfate, which will precipitate cadmium in the media.<br />
<br />
Our aim in Mod 2 is to use this strain of hydrogen sulfide producing yeast and engineer a cell surface display system to display a peptide of your design in order to capture precipitating cadmium. We will then assess the quantity of cadmium captured as well as it's quality for recycling back into the manufacturing process.<br />
<br />
<br />
<font color= #015526 >'''Research goal: Genetically engineer a cell surface display peptide to capture cadmium in a model of bioremediation '''</font color><br />
<br />
<br />
<br />
[[Image:Sp24 Mod2 overview.png|center|750px|thumb|Image generated using BioRender.]]<br />
<br />
<br />
<br style="clear:both;"/><br />
<br />
==Lab links: day by day==<br />
M2D1: [[20.109(S24):M2D1 |Determine peptide design strategy]] <br> <br />
M2D2: [[20.109(S24):M2D2 |Clone cell surface peptide display plasmid]] <br> <br />
M2D3: [[20.109(S24):M2D3 |Sequence clones and transform into yeast]] <br> <br />
M2D4: [[20.109(S24):M2D4 |Align sequencing and prepare for Journal Article presentations]] <br> <br />
M2D5: [[20.109(S24):M2D5 |Perform flow cytometry and harvest cells to test cadmium sequestration]] <br> <br />
M2D6: [[20.109(S24):M2D6 |Quantify cadmium removal from media]] <br><br />
M2D7: [[20.109(S24):M2D7 |Visualize cadmium sequestration and assess quality of cadmium sulfide production]] <br><br />
M2D8: [[20.109(S24):M2D8 |Complete data analysis and organize Research Article figures]] <br><br />
<br />
==Major assignments==<br />
[[20.109(S24):Journal article presentation| Journal article presentation]] <br><br />
[[20.109(S24):Research article|Research article]] <br><br />
<br />
==References==<br />
<br />
*[[Media:Sun Belcher 2019.pdf | Designing yeast as plant-like hyperaccumulators for heavy metals]]<br />
*[[Media:Sp20 M3 reference ChaoNat.pdf |Isolating and engineering human antibodies using yeast surface display.]]<br />
*[[Media:Sun Belcher 2020 yeast waste water.pdf |Using yeast to sustainably remediate and extract heavy metals from waste waters]]<br />
<br />
==Notes for Instructors==<br />
[[20.109(S24): Prep notes for M2| Prep notes for M2]]</div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T21:41:44Z<p>Becky Meyer: /* Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
There are many approaches to environmental remediation with the most common categories being physical, chemical, and biological remediation. Physical and chemical remediation are expensive and sometimes destructive procedures, so interest has turned to applying principles from these techniques to create more advanced bioremediation systems.<br />
<br />
In this module, we will be taking advantage of a known chemical interaction: that of hydrogen sulfide with metals. When hydrogen sulfide comes into contact with free heavy metals, it is able to transform those metals into metal sulfides which precipitate out of solution where they can then be captured. Instead of chemically introducing hydrogen sulfide gas into our cultures (H<sub>2</sub>S can be difficult to handle), we will be using bakers yeast that have been genetically modified to produce controlled amounts of H<sub>2</sub>S. To create this yeast strain, the ''Met17'' gene was knocked out. Yeast media contains sulfates which are metabolically converted to amino acids. Different sources of sulfate are converted into homocysteine through parallel pathways. Homocysteine is then converted to the amino acids cysteine and methionine (see diagram below). <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
Normally, ''Met17'' is responsible for converting the H<sub>2</sub>S intermediary into homocysteine. Therefore, by removing ''Met17'' from the yeast, we are able to produce an excess of H<sub>2</sub>S. We ramp up H<sub>2</sub>S production by our knockout yeast even further by limiting the presence of cysteine and methionine amino acids in our media, causing the yeast to produce more H<sub>2</sub>S in an effort to produce these amino acids necessary for metabolic functions.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*There are other ways to genetically modify our yeast to produce H<sub>2</sub>S. Explain the effects of knocking out the following genes.<br />
**''CYS4''<br />
**''MET6''<br />
**''SER1''<br />
**''HOM6''<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide. Yeast cell surface display (YSD) is a very useful biotechnology to determine protein-protein interactions as well as cell interactions with each other and other elements in their environment. It has been used as a technique for library screening, vaccine development, as part of biosensor systems, and many other applications.<br />
<br />
While there are many version of YSD, all forms involve the attachment of a protein of interest to an anchor integrated into cell surface. One common approach to YSD is the Aga1-Aga2 system developed by Eric Boder and Dane Wittrup. In this approach, the Aga1 protein anchors itself to glycosylphosphatidylinositol (GPI) on the extracellular side of the yeast cell surface membrane. The Aga1 protein can bind to another protein called Aga2 through disulfide bonds. The YSD system takes advantage of this interaction and fuses a protein of interest to Aga2 so that the protein of interest is anchored at the cell surface using the stable interaction of Aga1 and Aga2. To create our YSD system, we use a plasmid that expresses Aga2 and our peptide of interest. To enable detection of our peptide expression, an HA tag and myc tag are added to either end of the peptide of interest in the plasmid.<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T21:31:30Z<p>Becky Meyer: /* Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
There are many approaches to environmental remediation with the most common categories being physical, chemical, and biological remediation. Physical and chemical remediation are expensive and sometimes destructive procedures, so interest has turned to applying principles from these techniques to create more advanced bioremediation systems.<br />
<br />
In this module, we will be taking advantage of a known chemical interaction: that of hydrogen sulfide with metals. When hydrogen sulfide comes into contact with free heavy metals, it is able to transform those metals into metal sulfides which precipitate out of solution where they can then be captured. Instead of chemically introducing hydrogen sulfide gas into our cultures (H<sub>2</sub>S can be difficult to handle), we will be using bakers yeast that have been genetically modified to produce controlled amounts of H<sub>2</sub>S. <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide. Yeast cell surface display (YSD) is a very useful biotechnology to determine protein-protein interactions as well as cell interactions with each other and other elements in their environment. It has been used as a technique for library screening, vaccine development, as part of biosensor systems, and many other applications.<br />
<br />
While there are many version of YSD, all forms involve the attachment of a protein of interest to an anchor integrated into cell surface. One common approach to YSD is the Aga1-Aga2 system developed by Eric Boder and Dane Wittrup. In this approach, the Aga1 protein anchors itself to glycosylphosphatidylinositol (GPI) on the extracellular side of the yeast cell surface membrane. The Aga1 protein can bind to another protein called Aga2 through disulfide bonds. The YSD system takes advantage of this interaction and fuses a protein of interest to Aga2 so that the protein of interest is anchored at the cell surface using the stable interaction of Aga1 and Aga2. To create our YSD system, we use a plasmid that expresses Aga2 and our peptide of interest. To enable detection of our peptide expression, an HA tag and myc tag are added to either end of the peptide of interest in the plasmid.<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T21:31:03Z<p>Becky Meyer: /* Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
There are many approaches to environmental remediation with the most common categories being physical, chemical, and biological remediation. Physical and chemical remediation are expensive and sometimes destructive procedures, so interest has turned to applying principles from these techniques to create more advanced bioremediation systems.<br />
<br />
In this module, we will be taking advantage of a known chemical interaction: that of hydrogen sulfide with metals. When hydrogen sulfide comes into contact with free heavy metals, it is able to transform those metals into metal sulfides which precipitate out of solution where they can then be captured. Instead of chemically introducing hydrogen sulfide gas into our cultures (HS<sub>2</sub> can be difficult to handle), we will be using bakers yeast that have been genetically modified to produce controlled amounts of HS<sub>2</sub>. <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide. Yeast cell surface display (YSD) is a very useful biotechnology to determine protein-protein interactions as well as cell interactions with each other and other elements in their environment. It has been used as a technique for library screening, vaccine development, as part of biosensor systems, and many other applications.<br />
<br />
While there are many version of YSD, all forms involve the attachment of a protein of interest to an anchor integrated into cell surface. One common approach to YSD is the Aga1-Aga2 system developed by Eric Boder and Dane Wittrup. In this approach, the Aga1 protein anchors itself to glycosylphosphatidylinositol (GPI) on the extracellular side of the yeast cell surface membrane. The Aga1 protein can bind to another protein called Aga2 through disulfide bonds. The YSD system takes advantage of this interaction and fuses a protein of interest to Aga2 so that the protein of interest is anchored at the cell surface using the stable interaction of Aga1 and Aga2. To create our YSD system, we use a plasmid that expresses Aga2 and our peptide of interest. To enable detection of our peptide expression, an HA tag and myc tag are added to either end of the peptide of interest in the plasmid.<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T21:28:16Z<p>Becky Meyer: /* Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
There are many approaches to environmental remediation with the most common categories being physical, chemical, and biological remediation. Physical and chemical remediation are expensive and sometimes destructive procedures, so interest has turned to applying principles from these techniques to create more advanced bioremediation systems.<br />
<br />
In this module, we will be taking advantage of a known chemical interaction: that of hydrogen sulfide with metals. When hydrogen sulfide comes into contact with free heavy metals, it is able to transform those metals into metal sulfides which precipitate out of solution where they can then be captured. Instead of chemically introducing hydrogen sulfide gas into our cultures (<br />
<br />
we will be used a genetically modified yeast strain capable of producing controlled amounts of hydrogen sulfide. <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide. Yeast cell surface display (YSD) is a very useful biotechnology to determine protein-protein interactions as well as cell interactions with each other and other elements in their environment. It has been used as a technique for library screening, vaccine development, as part of biosensor systems, and many other applications.<br />
<br />
While there are many version of YSD, all forms involve the attachment of a protein of interest to an anchor integrated into cell surface. One common approach to YSD is the Aga1-Aga2 system developed by Eric Boder and Dane Wittrup. In this approach, the Aga1 protein anchors itself to glycosylphosphatidylinositol (GPI) on the extracellular side of the yeast cell surface membrane. The Aga1 protein can bind to another protein called Aga2 through disulfide bonds. The YSD system takes advantage of this interaction and fuses a protein of interest to Aga2 so that the protein of interest is anchored at the cell surface using the stable interaction of Aga1 and Aga2. To create our YSD system, we use a plasmid that expresses Aga2 and our peptide of interest. To enable detection of our peptide expression, an HA tag and myc tag are added to either end of the peptide of interest in the plasmid.<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T21:23:09Z<p>Becky Meyer: /* Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
There are many approaches to environmental remediation with the most common categories being physical, chemical, and biological remediation. Physical and chemical remediation are expensive and sometimes destructive procedures, so interest has turned to applying principles from these techniques to create more advanced bioremediation systems.<br />
<br />
In this module, we will be taking advantage of a known chemical interaction: that of hydrogen sulfide with metals. When hydrogen sulfide comes into contact with free heavy metals, it is able to transform those metals into metal sulfides which precipitate out of solution where they can then be captured. <br />
<br />
we will be used a genetically modified yeast strain capable of producing controlled amounts of hydrogen sulfide. <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide. Yeast cell surface display (YSD) is a very useful biotechnology to determine protein-protein interactions as well as cell interactions with each other and other elements in their environment. It has been used as a technique for library screening, vaccine development, as part of biosensor systems, and many other applications.<br />
<br />
While there are many version of YSD, all forms involve the attachment of a protein of interest to an anchor integrated into cell surface. One common approach to YSD is the Aga1-Aga2 system developed by Eric Boder and Dane Wittrup. In this approach, the Aga1 protein anchors itself to glycosylphosphatidylinositol (GPI) on the extracellular side of the yeast cell surface membrane. The Aga1 protein can bind to another protein called Aga2 through disulfide bonds. The YSD system takes advantage of this interaction and fuses a protein of interest to Aga2 so that the protein of interest is anchored at the cell surface using the stable interaction of Aga1 and Aga2. To create our YSD system, we use a plasmid that expresses Aga2 and our peptide of interest. To enable detection of our peptide expression, an HA tag and myc tag are added to either end of the peptide of interest in the plasmid.<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T20:44:47Z<p>Becky Meyer: /* Part 2: Review yeast cell surface display */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide. Yeast cell surface display (YSD) is a very useful biotechnology to determine protein-protein interactions as well as cell interactions with each other and other elements in their environment. It has been used as a technique for library screening, vaccine development, as part of biosensor systems, and many other applications.<br />
<br />
While there are many version of YSD, all forms involve the attachment of a protein of interest to an anchor integrated into cell surface. One common approach to YSD is the Aga1-Aga2 system developed by Eric Boder and Dane Wittrup. In this approach, the Aga1 protein anchors itself to glycosylphosphatidylinositol (GPI) on the extracellular side of the yeast cell surface membrane. The Aga1 protein can bind to another protein called Aga2 through disulfide bonds. The YSD system takes advantage of this interaction and fuses a protein of interest to Aga2 so that the protein of interest is anchored at the cell surface using the stable interaction of Aga1 and Aga2. To create our YSD system, we use a plasmid that expresses Aga2 and our peptide of interest. To enable detection of our peptide expression, an HA tag and myc tag are added to either end of the peptide of interest in the plasmid.<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T20:43:44Z<p>Becky Meyer: /* Part 2: Review yeast cell surface display */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide. Yeast cell surface display (YSD) is a very useful biotechnology to determine protein-protein interactions as well as cell interactions with each other and other elements in their environment. It has been used as a technique for library screening, vaccine development, as part of biosensor systems, and many other applications.<br />
<br />
While there are many version of YSD, all forms involve the attachment of a protein of interest to an anchor integrated into cell surface. One common approach to YSD is the Aga1-Aga2 system developed by Eric Boder and Dane Wittrup. In this approach, the Aga1 protein anchors itself to glycosylphosphatidylinositol (GPI) on the extracellular side of the yeast cell surface membrane. The Aga1 protein can bind to another protein called Aga2 through disulfide bonds. The YSD system takes advantage of this interaction and fuses a protein of interest to Aga2 so that the protein of interest is anchored at the cell surface using the stable interaction of Aga1 and Aga2. To create our YSD system, we use a plasmid that expresses Aga2 and our peptide of interest. To enable detection of our peptide expression, an HA tag and myc tag are added to either end of the peptide of interest in the plasmid.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T19:48:38Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence?<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T19:46:42Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids seem to be somewhat capable of capturing cadmium (the mid-range candidates)?<br />
*Which amino acids have the lowest likelihood of capturing cadmium?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/File:Hasan_Nanozyme-based_sensing_platforms.pdfFile:Hasan Nanozyme-based sensing platforms.pdf2024-03-10T16:19:10Z<p>Becky Meyer: Becky Meyer uploaded a new version of &quot;File:Hasan Nanozyme-based sensing platforms.pdf&quot;</p>
<hr />
<div></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T14:09:23Z<p>Becky Meyer: /* Part 2: Review yeast cell surface display */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T14:04:18Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are an excellent way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine-only peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots. The Belcher lab has found that if the cadmium sulfide precipitates rapidly, it will form amorphous structure. However, if the cadmium sulfide precipitates at a more moderate pace and is captured at a more moderate pace, it will be able to form more organized structures which ultimately emit a stronger fluorescent signal. <br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T13:53:35Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfide to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfide. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfide<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-10T13:52:53Z<p>Becky Meyer: /* Part 2: Review yeast cell surface display */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In this module, we will use yeast cell surface display to express a peptide which can capture precipitating cadmium sulfide<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T16:11:37Z<p>Becky Meyer: /* Part 4: Choose a peptide sequence and determine a DNA sequence to encode it */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|600px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T16:11:20Z<p>Becky Meyer: /* Part 4: Choose a peptide sequence and determine a DNA sequence to encode it */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|500px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T16:10:50Z<p>Becky Meyer: </p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T16:09:35Z<p>Becky Meyer: /* Part 4: Choose a peptide sequence and determine a DNA sequence to encode it */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T16:09:21Z<p>Becky Meyer: /* Part 4: Choose a peptide sequence and determine a DNA sequence to encode it */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
<br />
It is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T16:08:26Z<p>Becky Meyer: /* Part 4: Choose a peptide sequence and determine a DNA sequence to encode it */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium. Using the DNA sequences corresponding to each nucleotide, you can create sequences to become primers for use in sit-directed mutagenesis cloning to insert your sequence in the yeast display vector. Although the process of choosing the DNA sequence for amino acid codons is straightforward, certain codons can be created from more than one DNA sequence. Here is where you will want to consider technical strategy in cloning. <br />
<br />
The instructors will take your desired DNA sequence and flank it with additional oligos to orient it correctly in the pCTCON2 vector. In so doing, we will be able to address most of the parameters listed below for successful primer design.<br />
<br />
Successful DNA primers tend to follow the following parameters:<br />
*Primers should be 25-45 bp long.<br />
*'''G/C content of 40-60% is desired.'''<br />
*Both primers should terminate in at least one G or C base.<br />
*Melting temperature should exceed 78&deg;C, according to:<br />
**T<sub>m</sub> = 81.5 + 0.41 (%GC) – 675/N - %mismatch <br />
**where N is primer length and the two percentages should be integers<br />
<br />
However, it is helpful for your chosen DNA sequence to not be exceptionally GC rich so that we can keep an overall GC content of primers to 40-60%. This is worth keeping in mind when you are choosing between different potential sequences for the amino acid codon you want to encode.<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T15:25:00Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium sulfate<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium.<br />
ADD WAY MORE<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T15:17:04Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
With your lab partner, use these parameters to determine the peptide you would like to display on the surface of &#x394;Met17 yeast to capture precipitating cadmium for recycling.<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which peptide sequence is your choice?<br />
*What is your rationale for choosing this peptide sequence.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium.<br />
ADD WAY MORE<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T15:09:06Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|'''Stability constants of cadmium with amino acids.''' Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|'''Percent change in cadmium precipitation with amino acids.''' Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|'''Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence.''' Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium.<br />
ADD WAY MORE<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T15:07:36Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|Stability constants of cadmium with amino acids. Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|Percent change in cadmium precipitation with amino acids. Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence. Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
In order to design a cell surface display peptide that is capable of capturing precipitating sulfide in ordered particle formation, you will need to consider the:<br />
#Amino acid residue binding to cadmium<br />
#Sequence of amino acids in the peptide<br />
#Length of peptide<br />
#*The Belcher lab chose to display hexapeptides, however you can choose between 1-8 amino acids to comprise your displayed peptide.<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium.<br />
ADD WAY MORE<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyerhttp://measurebiology.org/wiki/20.109(S24):M2D120.109(S24):M2D12024-03-09T14:55:09Z<p>Becky Meyer: /* Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids */</p>
<hr />
<div><div style="padding: 10px; width: 820px; border: 5px solid #434a43;"><br />
{{Template:20.109(S24)}}<br />
<br />
==Introduction==<br />
<br />
[[Image:Sp24 yeast model.png|thumb|right|400 px|'''Schematic of yeast H<sub>2</sub>S precipitation model.''' Model system where yeast production of hydrogen sulfide precipitates metal from media, which can then be captured by yeast cell surface display. Adapted from Sun ''et. al''. 2020. ''Nature Sustainability'']]<br />
Heavy metals are typically thought of as metal elements with a relatively high density. Many of these metals are considered precious (gold, silver, platinum) or have commercial value (lead, copper, nickel). Other metals can play an essential health role in small quantities (zinc, iron, manganese). However many of these metals are toxic, even when present in parts per billion. Heavy metals can be released into the environment through a number of activities such as mining, industrial production of consumer products, or disposal of electronic waste.<br />
<br />
In this module, you will focus on protein engineering of a cell surface display peptide in ''Saccharomyces cerevisiae'', also known as baker's yeast. We are using this YSD (yeast cell surface display) model to capture the heavy metal cadmium in a recyclable form. This type of protein engineering is an early step in optimizing a "bioremediation" model system. Bioremediation is an approach to cleaning up environmental pollutants by repurposing a known biological process. Typically, bioremediation utilizes microbial and fungal organisms to remove environmental contaminants as these single cell organisms can be fast growing and genetically tractable (i.e. relatively simple to genetically manipulate). <br />
<br />
Today you examine what is known about our current ''S.cerevisiae'' bioremediation model system. You will explore the genetic metabolic engineering used to induce the yeast to produce hydrogen sulfide, examine the components of yeast cell surface display, and examine previously expressed peptides. You will use this information to rationally design a peptide to express on the yeast cell surface in order to capture Cadmium particles in the most uniform distribution possible. The rest of the module will be devoted to expressing your chosen peptides in our yeast model system, and testing these peptides for their suitability in bioremediation.<br />
<br />
==Protocols==<br />
<br />
===Part 1: Review metabolic engineering approach to create &#x394;Met17 yeast===<br />
<br />
In this module, <br />
<br />
[[Image:Sp24 yeast metabolism.png|thumb|400px|center|'''Yeast metabolic pathway converting sulfate to amino acids. Met17 gene indicated in purple''' Adapted from Sun et al. 2020. Nature Sustainability]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*How<br />
<br />
===Part 2: Review yeast cell surface display===<br />
[[Image:Sp24 YSD peptide.png|thumb|300px|right|'''Yeast cell surface peptide display with tags''']]<br />
In the <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Based<br />
<br />
===Part 3: Examine data for &#x394;Met17 yeast cell surface amino acids===<br />
<br />
[[Image:Sp24 cadmium binding.png|thumb|300px|left|Stability constants of cadmium with amino acids. Adapted from Sovago & Varnagy. 2013.]] Now that you have noted relevant information regarding the &#x394;Met17 YSD model system, it's time to turn your attention to our metal of interest, cadmium. While there is limited information on the specific mechanism of cadmium capture by peptides, previous literature has indicated that amino acid residues form complexes of differing stability with cadmium. Using the table to the right, examine the reported affinities of cadmium for different amino acid residues. <br />
<br />
In previous work from the Belcher lab, the ability of particular amino acid residues to remove cadmium from spiked media was tested using yeast display. The results of that experiment are shown at right and detailed in Sun ''et. al'', 2020 (linked on the Mod2 landing page). [[Image:Sp24 amino acids.png|thumb|300px|right|Percent change in cadmium precipitation with amino acids. Adapted from Sun ''et al.'' 2020. Nature Sustainability]] This data can be compared to the stability data in the table to identify amino acid residues that consistently bind cadmium. In addition to providing additional evidence of cadmium binding to amino acids, the data from Sun ''et. al'' was generated using a yeast display model very similar to the one you will employ. <br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*Which amino acids seem like likely candidates to capture precipitating cadmium?<br />
*Which amino acids have lower affinity?<br />
<br />
After looking at these data, you may be convinced that a string of cysteine residues are the most effective way to capture cadmium. This is indeed true. As the Belcher lab has found, a hexapeptide of cysteine repeats will effectively capture cadmium in solution. However, they also found that the cadmium sulfide particles which bind to cysteine peptide motifs form more amorphous cadmium sulfide deposits than a peptide motif which included glycine residues (Gly-Cys-Cys-Gly-Cys-Cys). Our goal in this module is to capture cadmium in a usable form, with crystalline features that produce a strong fluorescent signal, so that we can recycle captured cadmium into valuable quantum dots.<br />
<br />
[[Image:Sp24 cadmium recycling.png|thumb|500px|center|Cadmium precipitate particle patterns and fluorescent emission vary based on cell surface peptide sequence. Top row shows diffraction patterns of precipitated cadmium sulfate. Cuvettes show fluroescent emission of captured cadmium sulfide which is quantified on the right. More structured fringe lattices of cadmium sulfide precipitation result in stronger fluorescent emission. Adapted from Sun ''et. al''. 2020]]<br />
<br />
===Part 4: Choose a peptide sequence and determine a DNA sequence to encode it ===<br />
Using the information you have gathered above, you can now determine what peptide you would like express in order to capture precipitating cadmium.<br />
ADD WAY MORE<br />
[[Image:Sp24 cDNA codon.png|thumb|center|700px| '''Oligo sequences for amino acid codons.''' Image created in Biorender.]]<br />
<br />
<font color = #4a9152 >'''In your laboratory notebook,'''</font color> complete the following:<br />
*What amino acid sequence have you decided?<br />
*What DNA sequence have you chosen to encode your peptide?<br />
<br />
'''Determine the DNA sequence you need to encode your amino acids and upload it to the Class Data page on the wiki before you leave.'''<br />
*These primers must be '''ordered by 6pm''' to arrive in time for your next experiment.<br />
*Anchor sequences will be added to your primers to orient the new sequence between the peptide tags. These sequences will be detailed in the next lab.<br />
<br />
==Navigation links==<br />
Next day: [[20.109(S24):M2D2 |Perform site-directed mutagenesis]] <br><br />
Previous day: [[20.109(S24):M1D8 |Organize Data summary figures and results]] <br></div>Becky Meyer