Talk:20.109(F17):Module 2

Fermentation product and gene targeted:

T/R

Team	Ethanol (E) or Acetate (A)	Gene targeted by CRISPRi gRNA	gRNA sequence (without tag at 3' end)	Locus targeted (eg. beginning of gene, putative promoter, -35 region)	Target template or nontemplate strand
red	Acetate	adhE	TTAACGCACTCGTAGAGCGTGTAAA	beginning of coding region
orange	Ethanol	pta-ack	CTATGGCTCCCTGACGTTTT
yellow	Ethanol	frdA	GCTGTGGGATAAAAACAATCTGGAG	minus 35 region	template strand
green	E	LdhA	ttgtgctataaacggcgagtttcat
blue	E	pta	ttcacgacaacgttcaataatcat
pink	Acetate	adhE	TTACTAAAAAAGTTTAACATTATCA	promoter region	template strand
purple	Acetate	adhE	TTTACTAAAAAAGTTTAACATTATC	' -35 region'	'template'
white	Acetate	adhE	CTGATAATGTTAAACTTTTT	promoter	non-template strand

W/F

Team	Ethanol (E) or Acetate (A)	Gene targeted by CRISPRi gRNA	gRNA sequence (without tag at 3' end)	Locus targeted (eg. beginning of gene, putative promoter, -35 region)	Target template or nontemplate strand
red	Ethanol	ack (indirectly, pta)	GTTTTTTTAGCCACGTATCAATTAT	promoter region of ack	Nontemplate strand
orange	Ethanol	ldhA	ATTCAACATCACTGGAGAAAGTCTT	promoter	template
blue	Ethanol	ackA	TTTTTAGCCACGTATCAATTAT	promoter region of ackA, starting at -32	nontemplate

M2D5/M2D7: sequencing data

T/R

Team	pgRNA sequencing
red	files
orange	files
yellow	files
green	files
blue	files
pink	files
purple	files
white	files

W/F

Team	pgRNA sequencing
red	files
orange	files
blue	files