Difference between revisions of "20.109(S22):Class data"
From Course Wiki
Becky Meyer (Talk | contribs) |
Becky Meyer (Talk | contribs) |
||
(3 intermediate revisions by one user not shown) | |||
Line 1: | Line 1: | ||
<div style="padding: 10px; width: 820px; border: 5px solid #434a43;"> | <div style="padding: 10px; width: 820px; border: 5px solid #434a43;"> | ||
{{Template:20.109(S22)}} | {{Template:20.109(S22)}} | ||
+ | |||
Latest revision as of 18:20, 6 May 2022
Contents
Module 1: Drug discovery
SDS-PAGE gel images
small molecule selections
T/R
W/F
Aggregation Results
[T/R Aggregation dropbox folder]
Localization Results
Module 2: Metabolic engineering
Diagnostic Digest gels
[T/R diagnostic digest folder ]
[W/F Diagnostic Digest Folder]
sgRNA_target sequences
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target coding or non-coding strand | Ethanol / Acetate Assay Results |
TR Red | Acetate (A) | aceE | gagtttcgatcggatccacgtcatt | beginning of gene | target coding strand | https://www.dropbox.com/scl/fi/im2nky48dz8dninn07pwk/TR_red_yield.xlsx?dl=0&rlkey=yhbf2t0sxdfmqxqkrrpc8hkah |
TR Orange | Ethanol (E) | gltA | gaacacaccttttgaaccgagagta | beginning of gene | target coding strand | orange data |
TR Yellow | Ethanol (E) | pta-ack | GTTTTTTTAGCCACGTATCAATTAT | -35 region | noncoding strand | https://1drv.ms/x/s!AvcscE3syv-CgQfF_d8w80nc90RM |
TR Green | Ethanol (E) | aceE | TTATTCCTTATCTATCTAATAACGT | -30 region | coding strand | https://www.dropbox.com/scl/fi/yr9yndhh1h3hp8z8x0upf/TRGreen_M2D6Analysis.xlsx?dl=0&rlkey=3szzyw9psr0wqh1jdkroc7h6p |
TR Blue | Acetate | aceE | GTCGCGAGTTTCGATCGGATCCACG | beginning of gene | coding strand | https://www.dropbox.com/s/cxxrl6zmj2ckeiy/TR_Blue_M2D6_Acetate_Data.xlsx?dl=0 |
TR Teal | Acetate | aceE | CGTCATTTGGGAAACGTTCT | beginning of gene | coding strand | https://www.dropbox.com/scl/fi/yic9bw46ltim14xbxudwk/TR-Teal-M2D6_data_analysis.xlsx?dl=0&rlkey=z62dl8p8a4sanabelbrh3lgpn |
TR Pink | ||||||
TR Purple | Ethanol | pta | GTAGGGATCAGCATAATAATAC | beginning of gene | coding (non-template) strand | https://mitprod-my.sharepoint.com/:x:/g/personal/alpusey_mit_edu/ET0pYqoAsbdMjiX3Kg8mItEB0BjTW_gz-6u_At07MqQxPw?e=MBvZ1U |
TR Grey | Ethanol | aceE | CGTCATTTGGGAAACGTTCTGACAT | beginning of gene | noncoding strand | https://docs.google.com/spreadsheets/d/15mpS30zxthBy3nxzGolYUSkcbeGWi7QR/edit?usp=sharing&ouid=116057108253329472008&rtpof=true&sd=true |
TR White | Ethanol | aceE | AGTTTCGATCGGATCCACGTCATTT | beginning of gene | targeting the coding strand (Non template) | https://www.dropbox.com/scl/fi/68akhe3zajc3gmvjlr40m/TR-White-Ethanol-Yield-Results.xlsx?dl=0&rlkey=cs9i029pdq8hyk2vuq6g3y3lb |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target coding or non-coding strand | Colorimetric Assay Results |
WF Red | Ethanol (E) | pta | gaccgacgctggttccggta | Beginning of coding sequence of gene | Coding | |
WF Orange | Ethanol (E) | pta | ttcgtagttcagagactgggcaaac | beginning of gene | coding | https://www.dropbox.com/s/e2glkl89k0e3n0j/WFOrangeEthanolAssay.xlsx?dl=0 |
WF Yellow | Ethanol (E) | ppc | CATTGCGTAGTAATGTCAGTATGC | beginning of gene | non-coding strand (template) | https://www.dropbox.com/s/oceuj929siygv6l/Sp22_M2D6_data_analysis_template.xlsx?dl=0 |
WF Green | Acetate (A) | ppc | CCCCAGACACCCCATCTTATCGTTT | promoter | coding strand (non template) | https://www.dropbox.com/s/yuajy4wjev9ejnn/Sp22_M2D6_data_analysis_template.xlsx?dl=0 |
WF Blue | Acetate (A) | adhE | ttcagcgacattagtaacagcc | beginning of the gene | coding strand (non-template) | https://www.dropbox.com/s/xfhwywkx9q81dfm/WFBlue_M2D6_data_analysis_template.xlsx?dl=0 |
WF Teal | ||||||
WF Pink | Ethanol (E) | ldhA | GTGATGTTGAATCACATTTAAGC | -35 | conding strand (non-template) | https://mitprod-my.sharepoint.com/:x:/g/personal/skykim_mit_edu/EVo2U1bwZYVMrI-QhOeU--YBpYk0ul4F-H-o2qfISl6Lkg?e=ht6H12 |
WF Purple | Acetate (A) | adhE | gttcagcgacattagtaacagccat | beginning of gene | coding strand (non-template) | https://mitprod-my.sharepoint.com/:x:/g/personal/sabrliu_mit_edu/EQLNILyBeihNsubxjolVF24BT-TTYja33Pdp7lkFifthTw?e=kqYsM8 |
WF Grey | ||||||
WF White | Acetate (A) | adhE | ACAATTTATTAACTGTTAGCTATAA | promoter (-10) | non-coding strand (template) | https://www.dropbox.com/scl/fi/a2u9gahr8lhvhxipvdj7x/White-Acetate-Data.xlsx?dl=0&rlkey=ow2gefah5hczpy3p8rb03efol |