20.109(F08): The grafting parlour
From Course Wiki
Contents
NOTES FROM 11.11 meeting with the artist from THE GRAFTING PARLOUR
Please edit and add information that I didn't capture
Nkuldell 16:39, 11 November 2008 (EST)
Initial themes
- Form brings questions about content
- Computational approaches represent nature but biology holds in itself the reality of nature
- Art can tilt and sway perspective
- Interactive technology (video, telecommunication) are time base media
Framing questions
- How to look at the world through nature’s point of view?
- How can artwork change itself during a show?
- How can artwork change as it travels from gallery to gallery?
- We value the history of an object but can an object have traces/memories of itself and its history?
- Is the human desire to “fix time” immutable?
- We think of our cells as making up us but they have a life of their own as well (circadian pulsing of neurons every 23.5 hours w/o stimulus). What is the biological memory that cells have of a day? What do cells have to say to us?
- Galleries usually carefully manage light/moisture/temperature to inhibit bacteria growth on art but is this just a romantic notion of art by masters and is the intervention needed? Can unpredictable evolution/passage/change of art be part of art?
Art/Science examples we considered
- Eduardo Kac
- Transgenetic Alba bunny: use of animals as art? Research was done for science then made accessible through art
- Specimen of Secrecy About Marvelous Discoveries, pt 1
- Specimen of Secrecy About Marvelous Discoveries, pt2
- Hyunkoo Lee: animatus= skeletons from animated characters. Notable for its performance of science, that the artist makes apparent. Some eerie some playful examples.
NOTES: about microscope/display
from Lucy 12.08.08
- There are ways to convert a webcam into a microscope [1] but my guess is that the magnification is not great.
- Weather microscope or document camera, it depends on how wide a view will be captured. Here is
one that works with existing analog microscopes: [2]
- And here is more information on the document camera that I've been looking
at: [3]
Primers to check Cln1:GFP and Cln2:GFP strains
Cln1= 1641bp
Forward: CCCT TTTCTCTCTATGCCCAT
- length = 21
- Tm = 54.3
- GC = 47.6
Reverse: CTAG ATGTTTGTAGGTGGGCA
- length = 21
- Tm = 54.3
- GC = 47.6
PCR product = 977bp
PCR product+GFP = 1690bp
Cln2 = 1638 bp
Forward: CACGGCATATTCTCCATTATC
- length: 21
- Tm = 50.9
- GC = 42.9
Reverse: GGTCTCTTTTTGGTACGTTTG
- length = 21
- Tm = 51.8
- GC = 42.9
PCR product = 804bp
PCR product+GFP = 1517bp