Difference between revisions of "Talk:20.109(F16):Module 2"
From Course Wiki
(→W/F: ethanol) |
MAXINE JONAS (Talk | contribs) (→M2D5/M2D7: sequencing data) |
||
Line 128: | Line 128: | ||
|[[Media:Instructors_ldhA.zip| ldhA files]] | |[[Media:Instructors_ldhA.zip| ldhA files]] | ||
|} | |} | ||
+ | |||
+ | ===M2D8: mixed-acid fermentation data=== | ||
+ | ====T/R: lactate==== | ||
+ | lactate | ||
+ | ====W/F: ethanol==== | ||
+ | [[ WF ethanol data.xlsx]] |
Revision as of 21:59, 9 November 2016
Contents
Module 2 Data
M2D2: gRNA design
T/R: lactate
Team | Gene targeted by CRISPRi gRNA |
gRNA sequence (without tag at 3' end) |
Locus targeted (e.g. beginning of gene, putative promoter, -35 region) |
yellow | pflB | TGTCGAAGTACGCAGTAAAT | putative promoter |
green | pflB | ATAAAAAATCCACTTAAGAAGGTA | Putative Promoter |
blue | pflB | TTCATTAAGCTCGGACATGTAACA | End of Putative Promoter & beginning of pflB gene |
pink | pflB | AAATAAAAAATCCACTTAAGAAGGT | Putative Promoter |
purple | pflB | AAATCCACTTAAGAAGGTAGGTGT | putative promoter |
W/F: ethanol
Team | Gene targeted by CRISPRi gRNA |
gRNA sequence (without tag at 3' end) |
Locus targeted (e.g. beginning of gene, putative promoter, -35 region) |
red | pta-ack | GCC ACG TAT CAA TTA TAG GTA C | putative promoter |
green | ldhA | GTAGCTTAAATGTGATTCAACATC | putative promoter |
blue | fdrA | CAAGATCGGCTTGAAAGGTTTGCAC | Beginning of gene |
purple | ldhA | TCGTACTGTTTTGTGCTATAAA | Beginning of coding sequence |
instructors | ackB | AGTACCTATAATTGATACGTGGCTA | promoter, -30 region |
instructors | ldhA | CTTAAATGTGATTCAACATCACTG | 5'UTR |
Note: The dCas9 recognition sequence is 5' - GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC - 3'.
M2D5/M2D7: sequencing data
T/R
Team | pgRNA sequencing |
yellow | files |
green | files |
blue | files |
pink | files |
purple | files |
W/F
Team | pgRNA sequencing |
red | files |
green | files |
blue | files |
purple | files |
instructors | ackB files |
instructors | ldhA files |
M2D8: mixed-acid fermentation data
T/R: lactate
lactate